ID: 1044004083

View in Genome Browser
Species Human (GRCh38)
Location 8:86920613-86920635
Sequence CATTCCCAACAGACTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044004083 Original CRISPR CATTCCCAACAGACTTCCTT GGG (reversed) Intronic
900741863 1:4335208-4335230 CTTTGCCAACAGCCTTCATTTGG - Intergenic
902383960 1:16065782-16065804 CATTCCCTACTGGCTTCCTCTGG + Intronic
904475178 1:30760255-30760277 CATTCCCAACAAACCCCCTGTGG + Intergenic
905651316 1:39658935-39658957 CATTCTCAACATCCCTCCTTTGG - Intergenic
906248795 1:44295575-44295597 AATTTCCAACAGGATTCCTTGGG + Intronic
908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG + Intergenic
914464515 1:147914331-147914353 CATTCATAACAAACTTCCTGGGG + Intergenic
915791419 1:158675974-158675996 CAGTCACAAAGGACTTCCTTTGG + Intronic
916029062 1:160861105-160861127 CAATCCCATCAGTCCTCCTTCGG + Intronic
916828510 1:168466769-168466791 CATTCCCAAGACAATTTCTTAGG + Intergenic
917546210 1:175971456-175971478 CATTTTCAACAAACTCCCTTTGG - Intronic
917562227 1:176170827-176170849 CTTGCCTAACAGACTTCTTTTGG - Intronic
921171060 1:212550019-212550041 GATTCCCAAAAGACCTCCTCTGG - Intergenic
921776972 1:219112315-219112337 CATCACCCACAGACTTCCATTGG + Intergenic
922082510 1:222310633-222310655 CATTCCCAACAGCCTAACTCAGG - Intergenic
1064258491 10:13765853-13765875 CATTCCCACCTGAATGCCTTGGG + Intronic
1066226533 10:33389011-33389033 CATTCCAAACAGCACTCCTTCGG - Intergenic
1068435081 10:56980206-56980228 CATTCCCACCATTCTGCCTTGGG + Intergenic
1069324609 10:67218062-67218084 CATTCCCAAGATAATTCATTAGG + Intronic
1071970113 10:90896472-90896494 CCTACCCTACAGAGTTCCTTTGG + Intronic
1072549978 10:96469890-96469912 CATTCCCCACACTCTTCCCTGGG - Intronic
1075251905 10:120886291-120886313 GATTCCCAACACATTTTCTTTGG - Intronic
1076665015 10:132082489-132082511 CATTCCCAAGTTACTTCATTTGG + Intergenic
1077125100 11:930221-930243 CACTCCCAGCAGACTGGCTTGGG + Intronic
1080064273 11:27991968-27991990 ATTTCCCAATAGACTGCCTTTGG + Intergenic
1080140813 11:28917734-28917756 CATTCCCAAGTTACTTCATTAGG - Intergenic
1081333185 11:41829779-41829801 TATTTCCAGCAGACTTCATTTGG - Intergenic
1084556016 11:69876244-69876266 ACTGCCCAACAGGCTTCCTTGGG - Intergenic
1084646365 11:70460970-70460992 CCTTCCCATCAGACTCCCCTGGG + Intergenic
1085774428 11:79352607-79352629 CATTCCCAACAGACAGGCCTGGG + Intronic
1088729347 11:112667114-112667136 CTTTTACAACATACTTCCTTTGG + Intergenic
1088841999 11:113635211-113635233 CCTTCCCAAAATACCTCCTTGGG + Intergenic
1089986617 11:122819991-122820013 GATGCCCAACAGACTGCCTGGGG - Intergenic
1093274146 12:17103161-17103183 TGTTCCTAACAGACCTCCTTTGG + Intergenic
1094449893 12:30573299-30573321 CTTTCCCAATAGACTCCCTCTGG + Intergenic
1094522388 12:31206485-31206507 CTTTCCCAACAGAGTGCATTCGG - Intergenic
1096589463 12:52648031-52648053 CATTCTCAACATCCTTTCTTGGG + Intronic
1098275206 12:68805707-68805729 CATTCCCTCCAGACTTTTTTTGG + Intergenic
1099413796 12:82362287-82362309 CTTTCCAGACAGACTTCCTGGGG + Intronic
1105180440 13:17736833-17736855 CATTCCCAGCAAATTTCTTTCGG + Intergenic
1105185779 13:17820418-17820440 CATTCCCAGCAAATTTCTTTCGG + Intergenic
1105200315 13:18046658-18046680 CATTCCCAGCAAATTTCTTTCGG + Intergenic
1109459523 13:62637779-62637801 CATTCCTAACAGAAATTCTTTGG - Intergenic
1113158541 13:107352987-107353009 CAACCCCAAGAGACTTCCTGGGG + Intronic
1113555162 13:111227976-111227998 CATTCCCCAAATACTTACTTTGG + Intronic
1114813902 14:25933026-25933048 AATTCTCAGCAGAATTCCTTTGG - Intergenic
1115010928 14:28543700-28543722 CATTCCCAAAAGATTTCGATGGG + Intergenic
1115940656 14:38605213-38605235 GATTCCCAAGAGAGTTCCTGTGG - Intergenic
1116743791 14:48792381-48792403 CAGTCCCTACTGACTTCCCTTGG - Intergenic
1119703227 14:76768955-76768977 GTTTCAGAACAGACTTCCTTGGG - Intronic
1120514037 14:85449159-85449181 CATTCCAATCAGACATTCTTTGG + Intergenic
1125759786 15:42088669-42088691 CAAGGCCAACAGCCTTCCTTGGG - Intronic
1127470687 15:59287344-59287366 CCTTCCCGACAGACTTTCTGAGG + Intronic
1130772417 15:86938183-86938205 ACTTCCCAGCAGACTTCCATGGG - Intronic
1132404347 15:101533332-101533354 CATTCCTATCAGCCTTCCTCGGG - Intergenic
1132511212 16:342518-342540 CATTACCCGCAGCCTTCCTTTGG + Intronic
1133494606 16:6304997-6305019 CCTTCCCAACAGATTCACTTTGG - Intronic
1136172913 16:28499083-28499105 CCCTCCCAACCGCCTTCCTTTGG - Intergenic
1137827662 16:51513335-51513357 CATTAGCTACAGACTTCATTAGG + Intergenic
1139741721 16:69041033-69041055 CATTCCCAGTTGACTTCCTATGG + Intronic
1146657794 17:34645280-34645302 CATTTCCAACAGCCCTCCTGTGG + Intergenic
1147294121 17:39467596-39467618 GGTTTCTAACAGACTTCCTTAGG + Intronic
1147869933 17:43579921-43579943 CCTCCCCAACAGAGTTCCTTGGG - Intergenic
1150632905 17:66892606-66892628 CGTTCCCAGCAGACTAACTTGGG + Intergenic
1154117100 18:11620703-11620725 CATGCCCAACTGACTTCTTGAGG - Intergenic
1154624707 18:16701072-16701094 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154652560 18:17083582-17083604 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154656405 18:17136508-17136530 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154658944 18:17171276-17171298 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154700497 18:17739867-17739889 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154720113 18:18008884-18008906 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154750970 18:18431679-18431701 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154831468 18:19538722-19538744 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1154852089 18:19822462-19822484 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1155817914 18:30338120-30338142 CATTCCCAAATGACTTTGTTAGG - Intergenic
1158143030 18:54277158-54277180 CATTCCCAAGAATATTCCTTAGG - Intronic
1158298710 18:56028386-56028408 CATTCTCATTAGCCTTCCTTGGG + Intergenic
1159292204 18:66437860-66437882 CAATCCCAACAGTCTTCAGTGGG - Intergenic
1161183806 19:2902444-2902466 TATTCCTGAGAGACTTCCTTAGG - Intronic
1164969406 19:32518402-32518424 CATTCCCAACAGCCTTTCAGTGG + Intergenic
925574908 2:5350227-5350249 AATTGCCCACGGACTTCCTTAGG - Intergenic
925936836 2:8772029-8772051 CCTTCCCACCAGACTAACTTGGG - Intronic
926349259 2:11980700-11980722 CATTCCCCACTGACTCCCATTGG + Intergenic
931112596 2:59127808-59127830 AATTCTTAACAGACTTCTTTAGG + Intergenic
932597078 2:73100765-73100787 CATTCCCAACAGGTTTTTTTTGG + Intronic
936514474 2:113173234-113173256 AATTCCCAACACACGTCCTCAGG - Intronic
941093138 2:161202009-161202031 CATTCCCCACAGAATTCATATGG - Intronic
941174984 2:162185830-162185852 GATTCCTAAAACACTTCCTTAGG + Intronic
943782178 2:191836908-191836930 TATTCCCAACAGGCTGCCCTTGG - Intronic
944352099 2:198741575-198741597 CAATCCCAATAGACATCCTCTGG + Intergenic
944863998 2:203842963-203842985 TATGCCCAAGAGACTTCCTTGGG - Intergenic
1169520808 20:6370936-6370958 CATTCCCAGCAGCCTTCACTTGG - Intergenic
1170307146 20:14951071-14951093 CATTCCCAACTGACTGACTGAGG - Intronic
1170823560 20:19774344-19774366 CATTCCTATCTGACTTCCTTTGG - Intergenic
1171602221 20:26769970-26769992 CATTCTCAAGAAACTTCGTTGGG + Intergenic
1171608305 20:26861416-26861438 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171612584 20:26925662-26925684 CATTCTCAAGAAACTTCGTTGGG + Intergenic
1171617058 20:26992632-26992654 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171626634 20:27136440-27136462 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171634397 20:27252705-27252727 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171652617 20:27525610-27525632 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171654714 20:27557228-27557250 CATTCTCAAGAAACTTCGTTGGG + Intergenic
1171662810 20:27678400-27678422 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171684895 20:28009707-28009729 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171706219 20:28330255-28330277 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171708430 20:28363556-28363578 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1171711081 20:28403486-28403508 CATTCTCAAGAAACTTCGTTGGG + Intergenic
1171935827 20:31274248-31274270 CATGCCCAAGAGAGCTCCTTGGG + Intergenic
1178575830 21:33789468-33789490 CATTTCCAAGAGACATCCTGAGG + Intronic
1182256723 22:29044519-29044541 CTTTACCAACAGAGTTCCCTTGG + Intronic
1185134111 22:49058978-49059000 CATTCTCTGCAGACTTCCCTGGG - Intergenic
1185407558 22:50662879-50662901 AATTCCCAGCAGGCTTTCTTGGG + Intergenic
952376213 3:32769764-32769786 CATTCCCACGTGACTTCCTAGGG - Intronic
953174531 3:40537907-40537929 TATTCCAAACAGCCTTCTTTTGG + Intronic
953370158 3:42380779-42380801 CTTTCCCACCACACTTCCATGGG + Intergenic
953704113 3:45218471-45218493 CAGTCCTATCAGACTTCCTGAGG - Intergenic
960039099 3:113131294-113131316 CTTTCCCAGCATACATCCTTTGG + Intergenic
960562377 3:119098969-119098991 CATTCCTAACCTACTCCCTTTGG + Intronic
961447100 3:126985960-126985982 CCTTCCCAGCAGACTTTGTTGGG + Intergenic
962806821 3:138933394-138933416 GATTCCAAACAGTCTTCCGTTGG - Intergenic
964015989 3:151947422-151947444 CATTCCTAAAGGACTTTCTTGGG + Intergenic
967018561 3:185503093-185503115 CTTTCCTAACAGTCTTTCTTGGG - Intergenic
968271715 3:197408173-197408195 AATTCCCAAAAGACATTCTTCGG - Intergenic
969554516 4:7897132-7897154 CATTTCCAACTGCCTTCTTTGGG + Intronic
972131522 4:35841117-35841139 CATTCAGAACAGACTTTCTCAGG - Intergenic
972180882 4:36463874-36463896 AATTCTTAACAGACTTTCTTAGG - Intergenic
975836810 4:78431296-78431318 CATTCCCAGGAGACTACTTTAGG + Intronic
976388225 4:84483481-84483503 AATCCCAAACAGACTTCGTTCGG + Intergenic
976871886 4:89804216-89804238 TATTCTCAACATATTTCCTTCGG - Intronic
979352933 4:119667059-119667081 CATTCCCAACATGCTGCCATGGG - Intergenic
981958784 4:150510615-150510637 CATTCCAACTTGACTTCCTTTGG + Intronic
982439372 4:155417147-155417169 CATTCCCACCAGTATTCCTCAGG + Intergenic
984413861 4:179432463-179432485 GGTTTCCAACAGACTGCCTTTGG - Intergenic
985305771 4:188538045-188538067 AATTCCTAACAGACTTATTTAGG + Intergenic
986294190 5:6423733-6423755 CAGTCCCACCAGACACCCTTTGG + Intergenic
986399447 5:7366072-7366094 CAATCCCAGAAGACTTCTTTTGG - Intergenic
988178590 5:27760783-27760805 CATTCCAATAAGACTTCATTGGG + Intergenic
989916213 5:49732376-49732398 CATTCCCAGTAAACTTCTTTAGG + Intergenic
989934973 5:50010225-50010247 CATTCCCAGTAAACTTCTTTAGG + Intergenic
994201405 5:96980278-96980300 GCTTCCCAACAGACTTCATGAGG - Intronic
994760076 5:103841145-103841167 CATTCCCCACAGACTGCTGTGGG + Intergenic
994865144 5:105259039-105259061 TATGGCCAACTGACTTCCTTGGG + Intergenic
999636093 5:153624254-153624276 CATTCACAACATTCTTCCTGGGG - Intronic
1000515828 5:162235742-162235764 CTTCTCCAACAGATTTCCTTGGG + Intergenic
1002015035 5:176314384-176314406 CAAGACCAACAGACTTCCTTTGG + Intronic
1005432643 6:25774647-25774669 CATTCCCAACAGCCAGCCTCAGG - Intronic
1007199940 6:40098793-40098815 CATGCCCTCCAGACTTGCTTGGG - Intergenic
1007390650 6:41547871-41547893 CACGCCAAACAAACTTCCTTGGG + Intronic
1012938689 6:105394992-105395014 CATTTCCAACAGAAGTCATTAGG + Intronic
1024787229 7:52922255-52922277 AATTTCCAAAGGACTTCCTTTGG - Intergenic
1026410503 7:70116619-70116641 CATTTGAAACAGAGTTCCTTTGG - Intronic
1030499240 7:110338629-110338651 CTTTTCCAGCAGACTACCTTTGG + Intergenic
1036151464 8:6302964-6302986 CTCTCCCAAGAGTCTTCCTTTGG - Intergenic
1037100287 8:15034941-15034963 AATTCCCAATAGGCTTTCTTAGG - Intronic
1037741439 8:21612213-21612235 TATTCCCAGCAGCCTTTCTTAGG - Intergenic
1038799556 8:30737265-30737287 ATTTCCCAACAGACTGCCTTTGG - Intronic
1039384376 8:37119519-37119541 CCTTCCCACCAGACTTCCTTTGG + Intergenic
1040627381 8:49164691-49164713 CATTCCCACCAGCATTGCTTGGG + Intergenic
1041256623 8:55984348-55984370 CATGCCCAACACACATCTTTGGG - Intronic
1043133424 8:76490374-76490396 ATTTTCCAACAGACTCCCTTTGG - Intergenic
1043700039 8:83274873-83274895 CTTTCCCAACAGCCTTTCTCTGG + Intergenic
1044004083 8:86920613-86920635 CATTCCCAACAGACTTCCTTGGG - Intronic
1044993717 8:97819078-97819100 CATTCCAGACAGTATTCCTTGGG - Intronic
1046766044 8:118071478-118071500 CATTGCCAACTTACTTTCTTTGG - Intronic
1053048921 9:34942295-34942317 CAGTGCCAGCAGACTTCTTTGGG - Intergenic
1057635703 9:96764235-96764257 CCATCCCAACAGACTACCCTGGG + Intronic
1061159167 9:128883195-128883217 CATTCTCAAAAGGCTTCCTGAGG - Intronic
1061788340 9:133044441-133044463 CATTCCCACGAGGCTTGCTTAGG - Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187535246 X:20135624-20135646 AATTCCCAAAAGACTTACCTTGG - Intronic
1188545888 X:31306489-31306511 AATTTCCCACAGATTTCCTTAGG + Intronic
1191290072 X:58786860-58786882 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191308907 X:59037508-59037530 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191326372 X:59271336-59271358 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191339414 X:59445683-59445705 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191360913 X:59732856-59732878 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191368450 X:59833657-59833679 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191377166 X:59950048-59950070 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191388609 X:60102966-60102988 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1191483603 X:61375132-61375154 CATTCTCAGCAAACTTCTTTGGG + Intergenic
1192587051 X:72327480-72327502 AATTCCCACCAGTTTTCCTTTGG - Intergenic
1196679261 X:118454228-118454250 CATTGGAAACTGACTTCCTTGGG + Intergenic
1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG + Intergenic
1202067720 Y:20958267-20958289 CATTCCCAATAAACTTGCTTTGG - Intergenic