ID: 1044006066

View in Genome Browser
Species Human (GRCh38)
Location 8:86938238-86938260
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044006066_1044006068 4 Left 1044006066 8:86938238-86938260 CCCATATCACTATCAGCATTTTG No data
Right 1044006068 8:86938265-86938287 AAGCCATTTGACAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044006066 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intronic