ID: 1044008434

View in Genome Browser
Species Human (GRCh38)
Location 8:86964297-86964319
Sequence CCAATGATGAAACGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 4, 2: 13, 3: 33, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044008434_1044008444 29 Left 1044008434 8:86964297-86964319 CCATTCTCCCGTTTCATCATTGG 0: 1
1: 4
2: 13
3: 33
4: 140
Right 1044008444 8:86964349-86964371 GCTATTCTTCCAACTAGATAAGG No data
1044008434_1044008440 2 Left 1044008434 8:86964297-86964319 CCATTCTCCCGTTTCATCATTGG 0: 1
1: 4
2: 13
3: 33
4: 140
Right 1044008440 8:86964322-86964344 TCCCATTTAGTGTTCTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044008434 Original CRISPR CCAATGATGAAACGGGAGAA TGG (reversed) Intronic
900830935 1:4964926-4964948 CCAAGGAAGTAAAGGGAGAACGG - Intergenic
901727489 1:11253483-11253505 ACATTGATGAAACAGAAGAAAGG - Intronic
903784455 1:25849013-25849035 CAAATTATGAAACCTGAGAATGG + Intronic
906414520 1:45610341-45610363 CAAAAGAAGAAATGGGAGAAAGG + Intronic
906780435 1:48568418-48568440 CCCAGGATGAACAGGGAGAAAGG - Intronic
909890119 1:80994867-80994889 CCAAGGATGAAAAGGAAGATGGG + Intergenic
910629299 1:89339761-89339783 CCAATGATGAGATGGGAGACTGG + Intergenic
912078997 1:105912217-105912239 CTAATGATGAGATGGGACAATGG + Intergenic
913213928 1:116604083-116604105 CCACAGAGGAAACAGGAGAAGGG + Intronic
914437998 1:147677645-147677667 CATATGATGAAAGGGCAGAAGGG + Intergenic
915075915 1:153307876-153307898 CCCATGATGAGAATGGAGAAAGG - Intronic
915389259 1:155526604-155526626 ACAATGAAGAAAGGGGAGATGGG - Intronic
916490273 1:165296285-165296307 CCATTGAGGAAAAGCGAGAAGGG + Intronic
919404609 1:197163128-197163150 GCAATGATGAACTAGGAGAAAGG + Intronic
919498185 1:198303136-198303158 AGAATGAGGAAACGGCAGAAGGG + Intronic
921115124 1:212082731-212082753 CGAATGAGGATAAGGGAGAAAGG + Intronic
923934819 1:238748455-238748477 CCAGTGATGAAATGGGGGAATGG + Intergenic
924461569 1:244264329-244264351 CCAAGGATGAAGTGGGTGAAGGG + Intergenic
1071201029 10:83220843-83220865 CCAATGACAAGAAGGGAGAACGG - Intergenic
1073513238 10:104055781-104055803 CTAATGATGGAACAGGAAAATGG - Exonic
1073729257 10:106270468-106270490 CCAATAATGAAATGGGAGAATGG + Intergenic
1074116559 10:110460914-110460936 GCAAAGATGGAACTGGAGAAAGG - Intergenic
1077013099 11:388186-388208 CCAGTGATAAAATGGGAGAATGG + Intergenic
1079989607 11:27232944-27232966 CCATTCATGAAACAGGAGATGGG - Intergenic
1084066461 11:66707250-66707272 CCACTGATGAAACTGGAACAGGG - Intronic
1085026326 11:73238679-73238701 CAGATGAGGAAACAGGAGAAGGG + Intergenic
1085874923 11:80394920-80394942 CCAAGGATAAAAATGGAGAAAGG + Intergenic
1086286636 11:85259269-85259291 CAAATGATGAAGCAGGAGAGAGG - Intronic
1087327516 11:96741853-96741875 CCTATGAGGATACAGGAGAAAGG + Intergenic
1087672341 11:101122682-101122704 CCACTCAGGAAATGGGAGAAAGG - Intronic
1088963306 11:114692361-114692383 CCAAGGATGAAGGGGGAGAATGG - Intronic
1089625382 11:119747898-119747920 GCAAAGGTGAAACGGGAGAAAGG + Intergenic
1090005708 11:123000524-123000546 CCCATGATGGGACTGGAGAAGGG - Intergenic
1091624086 12:2109368-2109390 CCAAACCTGAAACGTGAGAAGGG + Intronic
1092110091 12:5954104-5954126 TCAATGATGAAAGAGGAGACTGG - Intronic
1092258700 12:6941052-6941074 CCAATGAGAAAAGGGCAGAAAGG + Intronic
1092569832 12:9709728-9709750 CCAATGATGAGATGGAAGACTGG + Intergenic
1093369856 12:18353939-18353961 TCAATGATGAGATGGGAGAATGG - Intronic
1093430727 12:19082085-19082107 CCCATGATGGAAATGGAGAATGG + Intergenic
1094372005 12:29749285-29749307 CCAATGAAGAAATGGGGAAAAGG - Intronic
1094424140 12:30301378-30301400 GGAATGAGGAAAGGGGAGAAGGG + Intergenic
1097077783 12:56408091-56408113 CCAGTAATGAAATGGGACAATGG - Intergenic
1097140971 12:56902360-56902382 TCAATGATGAAATGAGAGAATGG + Intergenic
1099246391 12:80197828-80197850 CCAGTGAGGAAAGAGGAGAATGG - Intergenic
1100031192 12:90193536-90193558 ACAATCATCAAACGGGAAAATGG - Intergenic
1103743883 12:123109210-123109232 CCAATGAGTGAACAGGAGAAGGG + Intronic
1104220959 12:126784792-126784814 CCAAAGCTGAAACGAAAGAATGG + Intergenic
1106236540 13:27865962-27865984 CCACTGAGGAAAAGGGAAAAAGG + Intergenic
1106620559 13:31367170-31367192 CCAGTGATGAAGTGGGACAATGG + Intergenic
1107588520 13:41879416-41879438 CCAATGATGAAAGAGAAGAAAGG - Intronic
1108369855 13:49757907-49757929 CCACTGGGGAAACTGGAGAAAGG + Intronic
1109030529 13:57182992-57183014 CCAATGATGAAATGGGAGAATGG - Intergenic
1111275278 13:85938604-85938626 CCAATGATGAAATGGCAGAATGG + Intergenic
1112081705 13:95979415-95979437 CCAGGGATGAAACGGGTGAAGGG - Intronic
1112180161 13:97070325-97070347 TCAATGATGAAAGGGGAGAAAGG - Intergenic
1112218262 13:97459245-97459267 CAAATGATGAAAAGGGGGTAAGG + Intronic
1114874967 14:26705161-26705183 CCAATGATGAAATGCGGGAAAGG + Intergenic
1116967946 14:51033596-51033618 CCAAGGATGACAAGGGAGTAGGG - Intronic
1118331817 14:64821321-64821343 CCAACCATGAAAGGGGAGAGGGG - Intronic
1118369315 14:65123913-65123935 ACAATGATGAAACTGGAATAAGG - Intergenic
1119888103 14:78161349-78161371 CTGATGAGGAAAGGGGAGAAAGG + Intergenic
1120443496 14:84565764-84565786 CCAGTGATGAAATGTGAGAATGG - Intergenic
1122319750 14:100846965-100846987 CAAGTGATCAAAAGGGAGAAGGG + Intergenic
1122365238 14:101191271-101191293 GCAAGGATGAAACGAGAGAGCGG + Intergenic
1122430908 14:101642588-101642610 TCAAAAATGAAACGGGAGGAGGG + Intergenic
1122642230 14:103166657-103166679 CCCATGATGACATGGGAGAATGG + Intergenic
1124915783 15:33972190-33972212 ACCATGATAAAACGGGAGTAAGG + Intronic
1125434944 15:39634630-39634652 ACAATGAAGAAAGGGGAAAATGG - Intronic
1129752343 15:78075047-78075069 CCAAAGAGGAAACTGGAGCAGGG + Intronic
1134205673 16:12236220-12236242 CAAAAGATCAAACTGGAGAAGGG + Intronic
1135207346 16:20494403-20494425 CCAATGATGAAATAGGAGAGTGG + Intergenic
1135211539 16:20529229-20529251 CCAATGATGAAATAGGAGAGTGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139090913 16:63646044-63646066 ATAATGAAGAAAGGGGAGAATGG + Intergenic
1139205410 16:65023924-65023946 CCCAGGATGAAACAGGAGATTGG - Intronic
1139936677 16:70576653-70576675 TCGATGATGTAACTGGAGAAAGG + Exonic
1140777508 16:78263441-78263463 CCAAAGGTGAATGGGGAGAAGGG + Intronic
1142525683 17:538802-538824 ACAATGAAGAAACAGTAGAAAGG + Intronic
1144714917 17:17427188-17427210 CTAAGGATGAAATGGGAGAATGG + Intergenic
1148358870 17:46995669-46995691 TCCATGATGCAAAGGGAGAAGGG - Intronic
1151272856 17:73010270-73010292 CCGAAGATGAAAAGGGAGAAAGG - Intronic
1153428285 18:4989493-4989515 CCAATGATGAAATGGGAGAATGG - Intergenic
1155839760 18:30630657-30630679 CCAGTGATAAAATGGGAGAATGG - Intergenic
1159444576 18:68525472-68525494 CCCATGATGATACGAGACAAGGG + Intergenic
1164143520 19:22495011-22495033 CCAATGATGAGATGGGAGACTGG + Intronic
1167592808 19:50413625-50413647 CCAAGGATGCAACAGGAGAGTGG - Intronic
925310318 2:2877139-2877161 CAAATGATTTAACAGGAGAAGGG - Intergenic
925751597 2:7094657-7094679 CAAGGGATGAATCGGGAGAAGGG + Intergenic
926394585 2:12428076-12428098 CTAATGAGGAAACTGGAGAATGG + Intergenic
927609399 2:24523277-24523299 CCCATGATGTATGGGGAGAAGGG - Intronic
928688825 2:33777679-33777701 CCCATGGTGAAACTAGAGAATGG - Intergenic
932177213 2:69613845-69613867 CAAATGATCAAACAGGAGGAAGG + Intronic
933034174 2:77371572-77371594 TCATTGATGAAAAGAGAGAAAGG - Intronic
935370302 2:102339079-102339101 CCACTGAAGAAAGGGGAGCAGGG - Intronic
943903651 2:193472024-193472046 CCAGTGATAACATGGGAGAATGG + Intergenic
944494791 2:200295701-200295723 CCAAGGAAAAAACTGGAGAAAGG + Intergenic
1169956163 20:11105327-11105349 CCACTGATGATACAGAAGAAAGG + Intergenic
1171217601 20:23363146-23363168 TCATTGATGAGACTGGAGAAGGG + Intronic
1173218585 20:41111880-41111902 CCAATTATGACAAGTGAGAAGGG - Intronic
1174286728 20:49479401-49479423 CAAATGAGGAAGGGGGAGAAGGG + Intronic
1177124638 21:17181345-17181367 CCAATGATGAGATGGGAGAATGG - Intergenic
1177513829 21:22122435-22122457 CCAATGATGAGATGAGAGACTGG + Intergenic
1177992539 21:28055732-28055754 ACAAGGATGAGACGGGAGAGGGG - Intergenic
949716567 3:6938669-6938691 CCAATTAAGAAATGTGAGAATGG - Intronic
952003175 3:28809834-28809856 CCAGTGATGAAATGGGAGATTGG - Intergenic
953609446 3:44435249-44435271 CCAGTGAGGAGATGGGAGAATGG - Intergenic
956557726 3:70541018-70541040 CCAGTGATGAATTGGGAGAATGG - Intergenic
956992698 3:74786487-74786509 CACATGATGAAAGGGAAGAAAGG + Intergenic
957821809 3:85386357-85386379 CCCATCCTGAAACTGGAGAATGG + Intronic
958632701 3:96702465-96702487 CCAATGATGAAGTGGAAGACTGG + Intergenic
959466959 3:106700260-106700282 CAAATGAAGAAACTGGATAAGGG - Intergenic
959510190 3:107202107-107202129 ACAATGATGAAACAGGAGCAGGG + Intergenic
960429152 3:117547537-117547559 GCAATGCTGAAAGGAGAGAAGGG - Intergenic
965197911 3:165623570-165623592 CCAATGACGAAATGGGAGAATGG - Intergenic
965563111 3:170080657-170080679 TCAATGATGAAACGGGAACTTGG + Intronic
966051005 3:175617930-175617952 CCGATGATGAAATGGGAGAATGG - Intronic
967608188 3:191473013-191473035 CCAATGATATAAAGGGAAAATGG - Intergenic
969078029 4:4595931-4595953 CCAAAGATAAAGCTGGAGAAGGG - Intergenic
971859922 4:32089563-32089585 CCAGTGATGAAATGAGAGAATGG - Intergenic
972299589 4:37772343-37772365 CCCATGAGCAAAGGGGAGAAAGG - Intergenic
972416579 4:38846729-38846751 CCAATGATAAGAAGGGAGAAGGG + Intronic
974250265 4:59376149-59376171 CCAGTGATGAGATGGGAGACTGG - Intergenic
976922196 4:90454580-90454602 TCAATGATGAAATGGGAGAATGG - Intronic
977045259 4:92061186-92061208 CCAATGCTGATACGGGAGCGGGG - Intergenic
978036882 4:104005893-104005915 CTATTGATAAAACGGTAGAAAGG - Intergenic
978999764 4:115201330-115201352 CCACTGAGGAAACAGCAGAAAGG - Intergenic
979136626 4:117118415-117118437 CCAATGATAAAATGGGAGAATGG - Intergenic
979188884 4:117833303-117833325 CCAATGATGAGATGGGAGACTGG - Intergenic
979919775 4:126481273-126481295 CCAATGATGAGATGGGAGAATGG + Intergenic
981679447 4:147379128-147379150 CCAATGATGAAAGTGTATAAAGG - Intergenic
986034668 5:3926172-3926194 TCACTGATGGAATGGGAGAAGGG - Intergenic
987086266 5:14471418-14471440 CCATTGATGAGATGGAAGAAAGG + Exonic
988604331 5:32667048-32667070 CCAGTGATGGAATGGGAGAATGG - Intergenic
988922998 5:35962007-35962029 CCAGTGTTGAAATGGGAGACTGG - Intronic
991165940 5:63565562-63565584 CCGATGATGAAATAGGAGAATGG + Intergenic
992568365 5:78025284-78025306 GCAATGATGCCAAGGGAGAAGGG + Intronic
994244946 5:97468186-97468208 CCAATGATGAAATGGGAGAATGG - Intergenic
994774592 5:104026472-104026494 CCAATGATGAGATGGGAGAATGG + Intergenic
998254770 5:140576323-140576345 CCAATGCTTAACCAGGAGAAAGG + Intronic
1000000336 5:157132378-157132400 CCAAGGATTAAATAGGAGAATGG - Intronic
1003998034 6:11563584-11563606 CAAATGATGAAACCTGAGGAGGG - Intronic
1009242820 6:61201284-61201306 CCAGTGGTGAAATGGGAGAATGG - Intergenic
1009626605 6:66144307-66144329 CCAATGATGAGAAGGGAGAATGG - Intergenic
1009633656 6:66234386-66234408 CGGAGGCTGAAACGGGAGAATGG + Intergenic
1011818567 6:91223109-91223131 CAAGTGATGCAACGGGATAATGG + Intergenic
1011978747 6:93343730-93343752 CCAAGGATGAAATGGATGAATGG - Intronic
1012113050 6:95260816-95260838 CCGATGATGAGATGGGAGAATGG - Intergenic
1013815288 6:114090636-114090658 CCAAAAAGGAAATGGGAGAAGGG - Intronic
1014277031 6:119399117-119399139 CCAATGATGAGATGGGAGAATGG - Intergenic
1014467398 6:121773134-121773156 CCAATGTTGAAAGGTGAGAGGGG + Intergenic
1014639324 6:123890230-123890252 CCAAAGATGACAGGGAAGAAAGG - Intronic
1019292931 7:259074-259096 CCAGCCATGAAACGGGGGAAAGG - Intronic
1023291297 7:38671528-38671550 CCAATGATGAGGCTGGAGGAGGG - Intergenic
1027947534 7:84767799-84767821 CCAAAGATAAAACGAGAGACAGG - Intergenic
1028235940 7:88361548-88361570 CAAATGATGAAACCTGAGGAGGG + Intergenic
1029937103 7:104437610-104437632 CAAATGATCAAACTGGAGAAGGG - Intronic
1030386940 7:108876704-108876726 CCAATGATGAGATGGGAAACTGG + Intergenic
1030435885 7:109519959-109519981 TCAAGGATGAAAGGAGAGAATGG - Intergenic
1031515632 7:122694829-122694851 TAAATGATGGAATGGGAGAATGG + Intronic
1032503413 7:132417231-132417253 CCAGAGATGAAATGGCAGAAAGG + Intronic
1034520939 7:151619240-151619262 CCAGTGATGAAGCTGGAGAACGG + Intronic
1035105857 7:156441072-156441094 CTTATGATGAAGCAGGAGAATGG - Intergenic
1037699456 8:21261730-21261752 CCAATGGTGAATGGGGAGGAGGG + Intergenic
1037960869 8:23097215-23097237 TCAATGATGAAACCTGAGAAGGG - Intronic
1038642295 8:29338147-29338169 CCAATGAGGAAGAGGGGGAATGG + Intronic
1044008434 8:86964297-86964319 CCAATGATGAAACGGGAGAATGG - Intronic
1044839024 8:96322387-96322409 CCCATGATGGAAGGGCAGAAGGG + Intronic
1045494685 8:102698553-102698575 CCAAAGAAGAAAGAGGAGAAAGG + Intergenic
1046209605 8:111052169-111052191 CCAAGGATAAAAGGGGATAAAGG - Intergenic
1046798171 8:118395020-118395042 CCACTGATGAGATGGGAAAACGG - Intronic
1047399608 8:124534849-124534871 CAAATGATCAAACCTGAGAAGGG - Intronic
1050254236 9:3777408-3777430 CCAAAGAGGAGAAGGGAGAAAGG + Intergenic
1051039495 9:12789699-12789721 CCTATGAAGAAACTGTAGAATGG - Intronic
1051483828 9:17587257-17587279 CCAGTGAGGAAAGGAGAGAAGGG + Intronic
1053076886 9:35141059-35141081 CCAATGATGAAATGGGAGAATGG + Intergenic
1055914636 9:81388630-81388652 CCACTGATGAAATGAGAGACTGG - Intergenic
1056327460 9:85491563-85491585 CCAATCCTGAAATGGAAGAAAGG - Intergenic
1058795572 9:108495238-108495260 CCAATTCTGAGACAGGAGAATGG + Intergenic
1058828511 9:108795519-108795541 CCAATGATGAGATGGGAGAATGG + Intergenic
1059577787 9:115509618-115509640 CCAATCATGTACCGAGAGAATGG + Intergenic
1059922840 9:119177605-119177627 CCAATGATGAGACACGAGAAAGG - Intronic
1061356383 9:130108733-130108755 AAAATGAGAAAACGGGAGAAGGG - Intronic
1062314867 9:135961635-135961657 CCAAAGAAGTAACGGGAAAAAGG + Intergenic
1189343206 X:40220215-40220237 CCAAAGATGAAAGCAGAGAATGG - Intergenic
1193244452 X:79211852-79211874 CCAATGATGATAGTGGTGAAGGG - Intergenic
1193574700 X:83183642-83183664 CCAATAATAAAATAGGAGAATGG - Intergenic
1194124041 X:89992004-89992026 CCAGTGATGAAATGGAAAAATGG - Intergenic
1194911296 X:99648038-99648060 GCAATCATGAAACTAGAGAAAGG - Intergenic
1195942831 X:110179584-110179606 CTTAGGATGAAACGGGAGAGTGG - Intronic
1197899543 X:131355301-131355323 ACAATAATGAAAGGAGAGAAGGG - Intronic
1200476929 Y:3649626-3649648 CCAGTGATGAAATGGAAAAATGG - Intergenic