ID: 1044016573

View in Genome Browser
Species Human (GRCh38)
Location 8:87053715-87053737
Sequence GCGTGACTGGTATGGATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044016565_1044016573 14 Left 1044016565 8:87053678-87053700 CCTAGCTCTCTGCTGGTGCTTCC 0: 1
1: 1
2: 1
3: 38
4: 325
Right 1044016573 8:87053715-87053737 GCGTGACTGGTATGGATCCCAGG No data
1044016566_1044016573 -7 Left 1044016566 8:87053699-87053721 CCCCTTTAACTCCCTTGCGTGAC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1044016573 8:87053715-87053737 GCGTGACTGGTATGGATCCCAGG No data
1044016568_1044016573 -9 Left 1044016568 8:87053701-87053723 CCTTTAACTCCCTTGCGTGACTG 0: 1
1: 0
2: 0
3: 4
4: 124
Right 1044016573 8:87053715-87053737 GCGTGACTGGTATGGATCCCAGG No data
1044016567_1044016573 -8 Left 1044016567 8:87053700-87053722 CCCTTTAACTCCCTTGCGTGACT 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1044016573 8:87053715-87053737 GCGTGACTGGTATGGATCCCAGG No data
1044016564_1044016573 15 Left 1044016564 8:87053677-87053699 CCCTAGCTCTCTGCTGGTGCTTC 0: 1
1: 1
2: 0
3: 22
4: 217
Right 1044016573 8:87053715-87053737 GCGTGACTGGTATGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044016573 Original CRISPR GCGTGACTGGTATGGATCCC AGG Intronic
No off target data available for this crispr