ID: 1044019393

View in Genome Browser
Species Human (GRCh38)
Location 8:87085832-87085854
Sequence AAGTACCATCTCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044019393_1044019394 -8 Left 1044019393 8:87085832-87085854 CCTGGGCTTCAGAGATGGTACTT 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1044019394 8:87085847-87085869 TGGTACTTTCTCAGTGATTCTGG No data
1044019393_1044019396 14 Left 1044019393 8:87085832-87085854 CCTGGGCTTCAGAGATGGTACTT 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1044019396 8:87085869-87085891 GCCCTAATCCAGCTAGGATTAGG No data
1044019393_1044019398 15 Left 1044019393 8:87085832-87085854 CCTGGGCTTCAGAGATGGTACTT 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1044019398 8:87085870-87085892 CCCTAATCCAGCTAGGATTAGGG No data
1044019393_1044019395 8 Left 1044019393 8:87085832-87085854 CCTGGGCTTCAGAGATGGTACTT 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1044019395 8:87085863-87085885 ATTCTGGCCCTAATCCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044019393 Original CRISPR AAGTACCATCTCTGAAGCCC AGG (reversed) Intronic
902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG + Intronic
903560561 1:24224164-24224186 GAGCACAAGCTCTGAAGCCCTGG + Intergenic
905134001 1:35784215-35784237 AAGGAGGATCTCTGGAGCCCAGG + Intergenic
905648852 1:39643227-39643249 AGGTACCATCTCCTAAGCTCAGG + Intergenic
906296549 1:44652294-44652316 AAGTGCCATCTCTCCAGCCTTGG - Intronic
907563488 1:55412707-55412729 AAGCACAGTCACTGAAGCCCAGG + Intergenic
907627187 1:56041712-56041734 AAGTGCCATCTATGAAGAACAGG - Intergenic
907831371 1:58067386-58067408 AACTACCAGCTCTGACACCCAGG + Intronic
912160133 1:106972845-106972867 AAGTACTATCTCTGAAACCAAGG - Intergenic
920191578 1:204197194-204197216 AAGTCCCCTCTCTGCACCCCTGG - Intergenic
921323004 1:213961537-213961559 AAGTACCATCTCTGACCCTAAGG + Intergenic
922226944 1:223653669-223653691 AACTCCCATCTGTGAAGCCTTGG + Intronic
923771884 1:236944750-236944772 AAGCACCATCTGTCAAGTCCAGG + Intergenic
1065436268 10:25706655-25706677 AAGGACTGTCTCTTAAGCCCAGG + Intergenic
1065448220 10:25824656-25824678 AAGTCACATCTCTGAAGTCAAGG - Intergenic
1065683916 10:28264861-28264883 CAGTACCATCTTAGAAGCCAAGG + Intronic
1068235183 10:54224495-54224517 CTGAACCATCTCTGAAGCTCTGG + Intronic
1070396182 10:76012956-76012978 ACATTCCATCTCTGAAGCACAGG - Intronic
1070567704 10:77616199-77616221 ATGTAGCATCTCTGAAGCCTAGG - Intronic
1075342328 10:121657137-121657159 AAATACCATCCCTGAAGGTCTGG - Intergenic
1075918419 10:126189670-126189692 GAGTGCCAGCTCTGTAGCCCAGG - Intronic
1076186353 10:128452666-128452688 AAGTACCAGCACCGAAGCCCTGG - Intergenic
1076507513 10:130987678-130987700 GAGTCCCAGCTCTGAGGCCCAGG + Intergenic
1078069824 11:8101167-8101189 AAGAACCTTCTTTGCAGCCCTGG + Intronic
1078820705 11:14878176-14878198 TAGTTCCAGATCTGAAGCCCAGG - Exonic
1080428082 11:32174257-32174279 CAGGAACATCTCTCAAGCCCAGG - Intergenic
1083519743 11:63297572-63297594 AAGGCCCAACTCTAAAGCCCTGG + Exonic
1083645113 11:64167589-64167611 TAGAACCTTCTCTGAAACCCTGG - Intergenic
1086574961 11:88329387-88329409 AAGGACAATCTCTTAAACCCAGG + Intronic
1090062165 11:123473498-123473520 AAGGAGGATCTCTGGAGCCCGGG - Intergenic
1090262560 11:125331890-125331912 GAGGACCATCTCAGAGGCCCCGG + Exonic
1091205001 11:133814707-133814729 CAGTGCCATCTCTGCAGCCCAGG + Intergenic
1096455081 12:51778203-51778225 AGTTATCTTCTCTGAAGCCCTGG - Intronic
1099304715 12:80938678-80938700 AAGTGGCATCTCTGAACCACTGG - Intronic
1101721850 12:107357315-107357337 AAATACCAGCTCTGAAAGCCTGG - Intronic
1103190104 12:118993912-118993934 AAGATCCATCCCTTAAGCCCAGG + Intronic
1104123720 12:125823609-125823631 AAGGACAATCTCTTGAGCCCGGG + Intergenic
1106101712 13:26698890-26698912 AAGTGCGTTCTCTGAAGACCAGG + Intergenic
1112578464 13:100658306-100658328 AGGTATCATCTCTGCAGCCCCGG + Intronic
1112708190 13:102096623-102096645 AAGTACCCTCTCTGAGTCTCTGG - Intronic
1113026793 13:105949260-105949282 AAGGACCACATGTGAAGCCCAGG - Intergenic
1113890538 13:113733003-113733025 AGGTCTCATCTCTGAACCCCAGG - Exonic
1116721118 14:48496720-48496742 AAGTTCTCTCTCTGTAGCCCAGG - Intergenic
1125640280 15:41224725-41224747 AAGTAGGATCACTTAAGCCCTGG + Intronic
1126122890 15:45269255-45269277 AAGGACCTTCTCTGGAGCCTTGG - Intronic
1129884178 15:79027024-79027046 GAGTCCCTTCTCTGTAGCCCTGG - Intronic
1129901415 15:79153924-79153946 AAGCACCATCTCTGAGGAACAGG - Intergenic
1130095542 15:80853044-80853066 CAGTACCATCTCTGGTGGCCAGG - Intronic
1133239947 16:4408316-4408338 AAGTGTCACCTCGGAAGCCCTGG - Intronic
1138959745 16:62014788-62014810 AAGGAACAGCTCAGAAGCCCAGG + Intronic
1139795930 16:69482767-69482789 AAGGCCCATCCCTTAAGCCCAGG - Intergenic
1141130128 16:81430608-81430630 AAGGAGCATCTCTTGAGCCCAGG + Intergenic
1141438817 16:84016238-84016260 AATTACCATCTGTGAAGGGCAGG - Intronic
1142204167 16:88774868-88774890 TATTACCATCTCTGAATGCCTGG - Intronic
1145880510 17:28349412-28349434 AAGGACCTCCTCTGCAGCCCGGG + Intronic
1147167307 17:38600489-38600511 ACTGACCATCTCTGAGGCCCAGG + Intronic
1149551770 17:57545910-57545932 AAGTGCCATTTGTGAAGACCTGG + Intronic
1152052718 17:77994292-77994314 CAGAAACATCTGTGAAGCCCAGG - Intergenic
1153697134 18:7655282-7655304 GAGGACCATCACTTAAGCCCAGG - Intronic
1155374799 18:25145073-25145095 AAAAACTATCTCTGTAGCCCTGG + Intronic
1157328542 18:46686491-46686513 CACTCCCATCCCTGAAGCCCAGG + Intronic
1158943678 18:62429884-62429906 AAGTATCAATTCTGAAGCACAGG + Intergenic
1160410067 18:78669167-78669189 CAGGACGATCTCTCAAGCCCAGG + Intergenic
1162519889 19:11173576-11173598 AGGTGACATCTCTGGAGCCCTGG - Intronic
1165475296 19:36026815-36026837 AAGTATAGTCCCTGAAGCCCAGG - Intronic
1166274436 19:41742588-41742610 AAGTGCCAACTCTGCTGCCCAGG - Intronic
1167684984 19:50950456-50950478 CAGTTCCATCCCTAAAGCCCTGG - Intronic
1167996011 19:53402789-53402811 AAGGAGGATCTCTGGAGCCCAGG - Intronic
925479078 2:4250562-4250584 AAGCACCATCTCTGGTGCCCAGG - Intergenic
925533377 2:4889355-4889377 AGGTACCATCTTTGAAGCAGAGG - Intergenic
926137675 2:10347916-10347938 AAGGACCATTTCAGAAGCCCTGG + Intronic
926211023 2:10869368-10869390 AAGTTGCATCTCCCAAGCCCCGG - Intergenic
926863037 2:17328800-17328822 AAGTTCCATCTCTTGAGGCCAGG - Intergenic
927074770 2:19566779-19566801 GAGTAGCATTTCTGAAGCCAAGG - Intergenic
928188968 2:29143957-29143979 AACTGCAATCTCTGAAGCCAGGG + Intronic
928986480 2:37186957-37186979 AAGTCTCATCTCTGAAGACATGG - Intronic
929417575 2:41759356-41759378 AAGTACTATATCTGAAGGCCAGG + Intergenic
932238494 2:70139790-70139812 AAGGACCCTCTCTGTTGCCCAGG - Intergenic
933940343 2:87239775-87239797 AAGAACCATCCCAGATGCCCTGG - Intergenic
935661826 2:105473266-105473288 AAATACTTTCTCTGATGCCCTGG + Intergenic
936374021 2:111925660-111925682 AAGTGACATCACTGAAGTCCGGG - Intronic
941789341 2:169534342-169534364 AAGTACCATCTTGGAAGCAGAGG + Intronic
946067856 2:217004981-217005003 AAGTTACAACTCTGAAGTCCTGG + Intergenic
948169936 2:235893221-235893243 AAGCACCATGTCTGTAGCGCGGG + Intronic
948699196 2:239749833-239749855 AGGTAGCATCTCTGCAGCCCTGG - Intergenic
1168959720 20:1860559-1860581 AAAAACCATGGCTGAAGCCCTGG - Intergenic
1169338458 20:4776746-4776768 AACTACCTTCTCAGAACCCCTGG + Intergenic
1170607890 20:17887454-17887476 TAGCACCATCTCTGAGGCCACGG + Intergenic
1170671516 20:18438801-18438823 AGGTACCATCTGTGAAGCAGAGG - Intronic
1172794452 20:37527451-37527473 GACCACCATCTCTGCAGCCCCGG - Intronic
1172939386 20:38644218-38644240 AAGCCCCATCCCTGAGGCCCAGG + Intronic
1173510799 20:43626818-43626840 AAGGACCATCTATTGAGCCCTGG + Intronic
1173743593 20:45419622-45419644 ATGTACCTTCTCTGAGCCCCTGG - Intronic
1174118837 20:48247269-48247291 AAGTTCCAGCTCTCAAGCCATGG + Intergenic
1174489784 20:50884753-50884775 AGGACCCATCTCTGAAGCTCGGG - Intergenic
1174684130 20:52437411-52437433 AAGTAGCATCTCTTAGGGCCAGG + Intergenic
1175995695 20:62811413-62811435 AGGCACCATCCCTGAAGCCCCGG - Intronic
1176263190 20:64194049-64194071 CAGAAACATCTCTGAAACCCTGG - Intronic
1177619739 21:23572719-23572741 AACTACCAGCTCTGAAGTGCTGG + Intergenic
1178803819 21:35821815-35821837 CAGGATCATCTCTGGAGCCCAGG + Intronic
1179518945 21:41929536-41929558 AAGGCCCATCTCAGAAGCCAGGG - Intronic
1184870574 22:47235377-47235399 CAGAACCATCTCTGAATCCCAGG - Intergenic
950156031 3:10722351-10722373 AAGGAGCATCTCTGAGACCCAGG + Intergenic
950870267 3:16222269-16222291 GAGGAACCTCTCTGAAGCCCAGG - Intronic
952419559 3:33118887-33118909 AAGTGCCAGCCCTGAAGCTCCGG + Intronic
954576668 3:51680141-51680163 CAGCACCATCTCTCAAACCCAGG - Intronic
957247520 3:77733547-77733569 CAGAACCATCTGTGAACCCCAGG + Intergenic
958632823 3:96703453-96703475 GGGTACCATCTCTGAAGCTCTGG - Intergenic
962240247 3:133746064-133746086 ACGGACCAGCTCTGCAGCCCTGG + Exonic
964422293 3:156516348-156516370 AAATACCTTCAGTGAAGCCCTGG - Exonic
965362138 3:167754298-167754320 AAGATGCATCTCTGTAGCCCAGG - Intronic
966192304 3:177282356-177282378 AAGTGCCATCTCTCAACTCCTGG - Intergenic
967816992 3:193808090-193808112 AAGAAGCATCTCTGAAGCCAGGG + Intergenic
967855661 3:194115558-194115580 AAGAACCAACCCTGAAGCCCAGG + Intergenic
969460910 4:7328458-7328480 CAGTCCCAGCTTTGAAGCCCTGG - Intronic
971242049 4:24898142-24898164 CAGGAGCATCTCTGAAGCCCCGG + Intronic
972523765 4:39887430-39887452 ATGAACCATCTCTGCATCCCTGG + Intronic
974801490 4:66824425-66824447 TACTACCATCTCTGCATCCCAGG - Intergenic
976622110 4:87139220-87139242 ATGTAGCATCCCTGAAGCCATGG - Exonic
979265763 4:118701207-118701229 AGGTACCAACTCTGTTGCCCAGG + Intronic
979772145 4:124540350-124540372 AAGTACCATCTGTGTACTCCTGG - Intergenic
982188215 4:152824364-152824386 CTGAACCATCTCTGAATCCCTGG - Intronic
982482146 4:155925006-155925028 AAGTCCCATCTCTTAACCCTGGG - Exonic
984030146 4:174594188-174594210 AAGTACCATCTCTTATTCCAGGG - Intergenic
986176381 5:5355544-5355566 AAGGACCATCCCAGAATCCCTGG - Intergenic
986783253 5:11086105-11086127 AAGTAACCCCTCTGCAGCCCTGG - Intronic
987227090 5:15853441-15853463 AAGTACCATCTCTCAACTCGAGG - Intronic
990449626 5:55922531-55922553 GAGAACCATCTCTGAAGACTGGG + Intronic
990841410 5:60083691-60083713 AAGTAGTATTTCTGAGGCCCAGG - Intronic
995177694 5:109197834-109197856 AAATAGCATCTCTGAAATCCTGG + Intergenic
996449219 5:123599882-123599904 CAGTAACATCTCTGAAGACTGGG + Intronic
997931916 5:138079637-138079659 TAGTAGTATCTCTAAAGCCCTGG - Intergenic
999528811 5:152438714-152438736 AAGTACCATGGCTGATACCCAGG - Intergenic
1000432133 5:161164669-161164691 GAGTAGCATCTCTAAAGGCCTGG + Intergenic
1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG + Intergenic
1003422119 6:5967984-5968006 AAGTACCATAGCAGAAGGCCAGG - Intergenic
1006970972 6:38044530-38044552 AATTACCATCTCTGCAGCAAAGG - Intronic
1013366655 6:109442345-109442367 AAGTACCATCTCTCTGTCCCAGG - Intronic
1013416794 6:109932825-109932847 AAGTATGGTCTCTGAGGCCCAGG + Intergenic
1015729806 6:136335851-136335873 CAGCTGCATCTCTGAAGCCCAGG - Intergenic
1017948224 6:159113975-159113997 AAGTAACCTCTCTGAATCTCAGG - Intergenic
1019075691 6:169386569-169386591 AAGCAGCATCCGTGAAGCCCAGG + Intergenic
1020570624 7:9856295-9856317 ATTTACCATTTCTAAAGCCCTGG - Intergenic
1022020278 7:26393732-26393754 AAGTACCTTCCGTGAACCCCAGG + Intergenic
1022138902 7:27475351-27475373 AGGTACCATCCTTGAAGCACAGG + Intergenic
1022288619 7:28979193-28979215 GAGGACTATGTCTGAAGCCCTGG + Intergenic
1023822794 7:43989234-43989256 CAGTCCTATCTCTGAAGCCCAGG + Intergenic
1024412604 7:49063241-49063263 AAGTACCATCTTTGAATTCTAGG + Intergenic
1028331210 7:89594349-89594371 AGGTACCATCTCTGAAACTGGGG + Intergenic
1029751058 7:102542649-102542671 CAGTCCTATCTCTGAAGCCCAGG + Intronic
1029769011 7:102641760-102641782 CAGTCCTATCTCTGAAGCCCAGG + Intronic
1030533039 7:110733862-110733884 AGGTACCATCTATGAAGCAGAGG + Intronic
1030757029 7:113299290-113299312 AAGTACCATGGCTTATGCCCTGG + Intergenic
1034521209 7:151621596-151621618 GTGTACCATCTCTGTTGCCCAGG + Intronic
1036150246 8:6290318-6290340 AATTTCCATCTTTGAAGCCATGG - Intergenic
1038000671 8:23388561-23388583 AAGTCCCAGCTCTGTCGCCCAGG - Intronic
1040545524 8:48395891-48395913 AAGTACCTTCTCTTAATTCCAGG + Intergenic
1042059223 8:64798929-64798951 AAGAACCAGCCCTGAAGGCCTGG + Intergenic
1043412474 8:80012337-80012359 TAGAACCATCTCTGAATCCTAGG + Intronic
1044019393 8:87085832-87085854 AAGTACCATCTCTGAAGCCCAGG - Intronic
1046646568 8:116792259-116792281 AAATACCATCTCTCAAGAGCTGG - Intronic
1047970370 8:130079100-130079122 CAGGACCATCTCTTGAGCCCAGG + Intronic
1048784256 8:138033904-138033926 AAGTAGTGTCTCTGAAACCCAGG + Intergenic
1048946725 8:139455633-139455655 GAGAACCCTCTCTGAAACCCAGG + Intergenic
1051697093 9:19780341-19780363 CACTGCAATCTCTGAAGCCCGGG + Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057428634 9:94974863-94974885 AAGTACCATCTGTGTGGCCTTGG + Intronic
1061434800 9:130554434-130554456 AAGGAGCATCTCTTGAGCCCAGG + Intergenic
1062095765 9:134702331-134702353 TTGTCCCATCTCTGCAGCCCTGG - Intronic
1186480379 X:9892158-9892180 CAGTAGGATCACTGAAGCCCAGG + Intronic
1187455841 X:19440600-19440622 AAGCACCACCTGTGAAGGCCAGG + Intronic
1189890741 X:45599816-45599838 ATGTGCCAACTCTGGAGCCCAGG - Intergenic
1189950990 X:46230685-46230707 AAAAAGCATCTCTGAAACCCTGG - Intergenic
1193818326 X:86130010-86130032 AAGTGCCATCTATGCAGCACTGG + Intergenic
1194100835 X:89701835-89701857 AAGTACCAAATCAGAATCCCTGG - Intergenic
1196737215 X:118990410-118990432 AAGTACTATCTATGAAACCGGGG + Intronic
1198563390 X:137877795-137877817 AATGATCATCTCTGAAGCCCTGG + Intergenic
1200221958 X:154395062-154395084 CAGGAGCATCTCTGGAGCCCAGG + Intronic
1200453790 Y:3362922-3362944 AAGTACCAAATCAGAATCCCTGG - Intergenic