ID: 1044021617

View in Genome Browser
Species Human (GRCh38)
Location 8:87112148-87112170
Sequence AAGAGTGAGCAGGCAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044021617_1044021624 29 Left 1044021617 8:87112148-87112170 CCATCATCTGCCTGCTCACTCTT 0: 1
1: 0
2: 1
3: 44
4: 390
Right 1044021624 8:87112200-87112222 TGTCTTCTCTGAGCTTCTTATGG No data
1044021617_1044021619 1 Left 1044021617 8:87112148-87112170 CCATCATCTGCCTGCTCACTCTT 0: 1
1: 0
2: 1
3: 44
4: 390
Right 1044021619 8:87112172-87112194 AATCTCTCCCATATTTAATGTGG No data
1044021617_1044021620 2 Left 1044021617 8:87112148-87112170 CCATCATCTGCCTGCTCACTCTT 0: 1
1: 0
2: 1
3: 44
4: 390
Right 1044021620 8:87112173-87112195 ATCTCTCCCATATTTAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044021617 Original CRISPR AAGAGTGAGCAGGCAGATGA TGG (reversed) Intronic
900341399 1:2191002-2191024 CAGAGTGAGAAGGCAGCTGATGG - Intronic
901258992 1:7857275-7857297 AAGGGTGAGTAGGGAGAGGAAGG - Intergenic
903214256 1:21834595-21834617 CAGAGCGGGCAGGCAGAAGATGG + Intronic
904450243 1:30606309-30606331 AGGAGGGAGGAGGCAGAGGATGG + Intergenic
904651044 1:32006153-32006175 TAGAGTGATGAGGCAGAGGAGGG + Intergenic
905883577 1:41479787-41479809 AGAAGTGGGAAGGCAGATGACGG - Intronic
905962064 1:42051426-42051448 AACAGTGAGGAGGCAGATGATGG - Intergenic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG + Intergenic
907485769 1:54777112-54777134 AGGAGTGAGCAGGCAGAACAAGG + Intergenic
907904447 1:58771712-58771734 CAAACTGAGCAGCCAGATGATGG - Intergenic
908387195 1:63653895-63653917 AAGAGGTTTCAGGCAGATGAGGG - Intronic
908517120 1:64904388-64904410 AAGAGAGAGAAGGAAAATGAGGG + Intronic
908922121 1:69207985-69208007 AAGAGTGAGCAGGAACAGAAAGG + Intergenic
909334487 1:74455762-74455784 CAGAATGAGGAGGCAGAGGAAGG - Intronic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
910274571 1:85435193-85435215 AATAGTGAGAAGGCAGGGGAAGG + Intronic
910625169 1:89298894-89298916 AAGAGTGAATAGGAAGATAAAGG - Intergenic
910791417 1:91054957-91054979 CAGAGTGAGAAGGCAGAGGTGGG + Intergenic
911725317 1:101236510-101236532 AAGTCTGAGGAGGCAGAGGACGG - Intergenic
913561461 1:120025054-120025076 AAGAGTGTGCAAGCAGAAAATGG + Intronic
913636667 1:120768547-120768569 AAGAGTGTGCAAGCAGAAAACGG - Intergenic
914215988 1:145628980-145629002 AAGAGAGAGGAGACAGATGATGG + Intronic
914282046 1:146184468-146184490 AAGAGTGTGCAAGCAGAAAACGG + Intronic
914468555 1:147951612-147951634 AAGAGAGAGGAGACAGATGATGG + Intronic
914543075 1:148635175-148635197 AAGAGTGTGCAAGCAGAAAACGG + Intronic
914623547 1:149435838-149435860 AAGAGTGTGCAAGCAGAAAACGG - Intergenic
914949369 1:152098882-152098904 AAGAGTGAGAAGGGAAAGGAAGG - Intergenic
914963508 1:152229057-152229079 ATGAGTCAGAAGACAGATGAAGG + Intergenic
915100374 1:153495043-153495065 AGGAGAGGGCAGGCAGAGGAAGG - Intergenic
915581633 1:156816424-156816446 AGGAGGGAGCAGGAGGATGAAGG - Intronic
915900373 1:159842469-159842491 ATGAGTAACCAGGCAGATGGAGG + Intronic
916217715 1:162411690-162411712 CAGGGAGAGCAGGCAGATGGAGG + Intronic
917832180 1:178903490-178903512 AAAAGTGAGAAGGGGGATGAGGG - Intronic
917981619 1:180273014-180273036 TAAAGGGAGCAGGAAGATGAAGG - Intronic
918549335 1:185722922-185722944 AAGACTGAACAGGCAGTTGCTGG - Intergenic
919685400 1:200479443-200479465 GGGAGTGAGCAGGCAGGTGGAGG - Intergenic
920263171 1:204703453-204703475 AAGAGTGTGCAGGGAGCTGGAGG - Intergenic
920399568 1:205668677-205668699 AGGAGTGGGCAGGAAGAGGAAGG + Intronic
920970622 1:210740814-210740836 GAGAGTGAGAAGGAAGAGGAGGG + Intronic
920980534 1:210830211-210830233 AGGAGTTTGTAGGCAGATGACGG - Intronic
921311895 1:213852937-213852959 AGGAGTGAGCAGCCAGCTCATGG + Intergenic
924184272 1:241471127-241471149 GGGGGTGAGCAGGCAGATGGAGG + Intergenic
924802918 1:247340758-247340780 GAGAGTGAAAAGGCAGATGAAGG + Intergenic
1063114310 10:3063460-3063482 AAGAGTGGGTAGGGAGAGGAGGG + Intergenic
1064277113 10:13916237-13916259 AGCGGTGACCAGGCAGATGATGG - Intronic
1065328468 10:24570473-24570495 AGGAGTGGGCAGGCAGAGGCTGG + Intergenic
1066193856 10:33079754-33079776 AAGAAGGAGCAGTCAGATGTTGG - Intergenic
1066280140 10:33909196-33909218 AAAAGGGAGCAGGGAGATCAAGG - Intergenic
1068997205 10:63221119-63221141 AAAAGTGGACAGGCAGATCATGG + Intronic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG + Intronic
1069823243 10:71240188-71240210 AAGAGTGAGCATGCCCATGGGGG - Intronic
1070287323 10:75093356-75093378 AGGAGAGAGGAGGCAGAGGATGG + Intergenic
1070606472 10:77901839-77901861 AAGAGTGTGCAGGGAGAAGTGGG - Intronic
1070968196 10:80542893-80542915 GACAGTGAGCAGGCATAGGAAGG - Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1072292503 10:93977125-93977147 AAGAGTGAGCAGCCAGGAGAAGG - Intergenic
1074296436 10:112193493-112193515 AAGGGCAAACAGGCAGATGATGG + Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1075463238 10:122632462-122632484 TAGATGGAGCAGGCAGAGGATGG - Intronic
1075889489 10:125934466-125934488 AATGTTGGGCAGGCAGATGAAGG + Intronic
1077556780 11:3229855-3229877 AAGAGGGAGCTGTCTGATGATGG + Intronic
1077727676 11:4691649-4691671 ACCAGTGAGCAGGAAAATGATGG + Intronic
1078990863 11:16644840-16644862 AAAAGTGAGCAGGCATATTGTGG - Intronic
1079161094 11:17995004-17995026 AAGAGTGAGAAAGCAGAAAAGGG + Intronic
1079740195 11:24049024-24049046 AGGACTTAGCAGGAAGATGAGGG + Intergenic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1080384097 11:31800219-31800241 AAAGGTGAGCAGGGAGATGCAGG - Intronic
1080591124 11:33723813-33723835 ACAAGTGAGCAGGGAGAGGAAGG + Intronic
1080738659 11:35042808-35042830 ATGACTGAGCAGGGACATGAAGG + Intergenic
1081915952 11:46730397-46730419 AGGAGTGAGCAGGCATATCTAGG + Intronic
1082753659 11:57049950-57049972 AAGAGTGAGCATGCACCAGAGGG - Intergenic
1082909857 11:58358959-58358981 CAGAGTGATGAGGTAGATGAGGG + Exonic
1082914959 11:58423151-58423173 CAGAGTGAGGAGGTAGATGAAGG + Exonic
1083952523 11:65964946-65964968 AAGTGGGAGCAGGGAGGTGAAGG + Intronic
1083977067 11:66131508-66131530 CAAAGTTAGCAGGTAGATGAGGG - Intronic
1084100905 11:66948392-66948414 AAGAGTGAGGAGGCAGAGGGAGG + Intronic
1084302087 11:68258588-68258610 CAGAGTGGGCAGGCAGTTGGTGG + Intergenic
1084959422 11:72708653-72708675 AAGAGTGAGGAGGCAGGCGCTGG + Intronic
1085286341 11:75364101-75364123 CAGAGTGGGCAGGGATATGATGG - Intergenic
1085456257 11:76666975-76666997 AAGAGGGAGCAGTCAGATGTGGG - Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086248053 11:84778846-84778868 TAGAGAAAGCAGGCAGAAGAAGG + Intronic
1086633601 11:89054464-89054486 TTGAATGAGCAGGCAGATGTAGG + Intronic
1087004288 11:93453901-93453923 AAGAGAGAGCAGGCTTTTGATGG - Intergenic
1087430011 11:98041631-98041653 AAGAAAGAGCAGGCAGAAGAAGG - Intergenic
1087628893 11:100627622-100627644 ACCAGTGCCCAGGCAGATGACGG - Intergenic
1088062224 11:105668757-105668779 TAGAGTGAAAAGGCAAATGATGG - Intronic
1088684347 11:112272423-112272445 ATGAGTGAGCAAGGAGATGGAGG - Intergenic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1090702344 11:129308149-129308171 AAGAGTCAGGAGGGAGAAGAGGG - Intergenic
1090759706 11:129825673-129825695 ATTAGTGAGCAGGCAGAGGCTGG - Intronic
1091087632 11:132737994-132738016 AATATTGAGCAGTTAGATGAGGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091918938 12:4289189-4289211 AAAACTCAGCAAGCAGATGAAGG + Intronic
1093334190 12:17880558-17880580 AAGAGAGAGCAGGTAGGTGCTGG + Intergenic
1095378166 12:41556811-41556833 AGGAGAGAGCAAGCAGGTGAAGG - Intronic
1095386169 12:41653217-41653239 AAGAGTGATCTGGCAGCTGTTGG + Intergenic
1095789979 12:46155710-46155732 AAGAGTAAGCTGGTAAATGAAGG - Intergenic
1096984129 12:55745193-55745215 AAGAGTTTGCTGGAAGATGAAGG + Intronic
1097221914 12:57456106-57456128 AAAAGTGAGCAGGGAGCTGTAGG - Exonic
1097699665 12:62807133-62807155 GAGAGTGAGGAGCAAGATGAGGG + Intronic
1098596219 12:72274670-72274692 AAGAGTGAGCAGACAAAGCACGG + Intronic
1098947871 12:76608408-76608430 TAGATTCAGGAGGCAGATGAGGG - Intergenic
1099029482 12:77507506-77507528 AAGAGTGAGTAGGCATAAAAGGG - Intergenic
1099606283 12:84805764-84805786 AAGAGTAAGCACTCTGATGAGGG - Intergenic
1100659344 12:96679815-96679837 AAGAATGAGAGGGCAGAAGAGGG - Intronic
1101771862 12:107759673-107759695 CACAGAGAGAAGGCAGATGAAGG + Intronic
1102672324 12:114630617-114630639 AAGAGTGAGATGTGAGATGAAGG + Intergenic
1102801363 12:115737304-115737326 AGGAGTGATCAGGGAGATGGGGG - Intergenic
1103261568 12:119593568-119593590 AACAGGGAACAGGCAGATGAAGG - Exonic
1104265660 12:127230430-127230452 AAAAATGAGCAAGGAGATGATGG + Intergenic
1105295392 13:19084916-19084938 AAGAATGAGCATGCAAATGGAGG + Intergenic
1105683317 13:22752122-22752144 GAGAGGGAGCAGGGAGAAGATGG - Intergenic
1105757844 13:23485792-23485814 AAGAGAGAGCAGTGAAATGAAGG + Intergenic
1105819454 13:24066694-24066716 AAGAGTGAGGAGGGGAATGAAGG - Intronic
1106016975 13:25878865-25878887 GAGAGTGGGAAGGCAGCTGATGG - Intronic
1106084826 13:26531991-26532013 AAGAATGAGCAGGCAATGGACGG + Intergenic
1106860724 13:33904697-33904719 AAGGGCGGGCAGGCAGATTAAGG - Intronic
1107361016 13:39618068-39618090 AAGAGAGAGGAGGAAGATGGAGG + Intergenic
1107999452 13:45892784-45892806 AGGAGGGAGGAGGCAGAGGAGGG + Intergenic
1108423304 13:50272412-50272434 GAGCTTGAGAAGGCAGATGAGGG + Intronic
1109298983 13:60570762-60570784 ATGAGGGTGCAGCCAGATGAGGG + Intronic
1109314461 13:60734038-60734060 AAGACAGAGCAGAAAGATGAGGG - Intergenic
1109838474 13:67890104-67890126 AACAGTCAGCAAACAGATGAAGG + Intergenic
1110292181 13:73819983-73820005 CAGAGAGAGGAGGCAGAGGAGGG + Intronic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1112329779 13:98468492-98468514 AGGAGTGAGCAGGCACAAGGAGG + Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113878007 13:113606611-113606633 GAGCGGGAGCAGGCAGCTGATGG - Intronic
1115445960 14:33490240-33490262 AAAATTGATCAGGCAGATAATGG - Intronic
1117654887 14:57944953-57944975 AAGGTTGGGCAGGCAGATGCTGG - Intronic
1118440337 14:65806196-65806218 ATGAGGGAGCAGGATGATGAGGG - Intergenic
1119644129 14:76336408-76336430 AATAGAGAGCAGGCAGCAGATGG + Intronic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1122826696 14:104374148-104374170 AAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1123028312 14:105438965-105438987 TAGAGTGGGCAGGCAGCTCAGGG - Intronic
1123803852 15:23851516-23851538 AAGAGTGATTAGACAGATGGAGG - Intergenic
1124053325 15:26219473-26219495 AGGGGTGGGCAGGCTGATGAAGG + Intergenic
1127124512 15:55799218-55799240 AAGAGAGAGAAGGAAGATAAAGG - Intergenic
1127186623 15:56487086-56487108 AACAGAGAGAAGGCAGATGATGG - Intergenic
1128143988 15:65322182-65322204 GAGAGGGAGCAGGGAGAAGAAGG - Intergenic
1128576059 15:68775950-68775972 AAGGGTGAGCAGGCCAAGGAGGG - Intergenic
1129138022 15:73571637-73571659 AAGAGTGCACAGGCAGAGGTCGG + Intronic
1130231881 15:82103411-82103433 TAGAGAAAGCAGGCAGAGGATGG + Intergenic
1130918401 15:88323977-88323999 AAGAGTGCTCAGGCAGCTGCTGG + Intergenic
1131097358 15:89664879-89664901 AAGAGTGACTATGCAGGTGAAGG + Exonic
1131141284 15:89978640-89978662 GAGAATGAGCTGGCAGATGGAGG + Intergenic
1131549217 15:93342221-93342243 ATGAGTGAGCAGGCTGAGGTGGG + Intergenic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132521066 16:389383-389405 GCGAGTGAGCTGGAAGATGAAGG + Intergenic
1134528434 16:14963032-14963054 AAGAGTATACAGGCAGATGCAGG + Intergenic
1135601413 16:23786995-23787017 GAGGGTGAGCAGGCAGATTTGGG + Intergenic
1137510021 16:49090977-49090999 AAGAGTGAGCATTCAGATGGAGG - Intergenic
1137616448 16:49850704-49850726 GAAAGTAAGCAGGCAGAGGATGG - Intronic
1139556928 16:67718471-67718493 AAGAGTGGACAGGGACATGAGGG - Intronic
1140195763 16:72854206-72854228 AAAAGTTAGCAGGCAGGGGAGGG - Intronic
1141153240 16:81579201-81579223 AACAATGAGGAGGAAGATGAAGG + Intronic
1141334129 16:83138925-83138947 ATGAGTGAGGAGGTAGAGGAAGG + Intronic
1142395652 16:89829719-89829741 AGGAGTGTGGAGGCAGCTGAGGG - Intronic
1143181379 17:4986491-4986513 AAGAGTGAGCAGGAAGAAATGGG + Intronic
1145286198 17:21507501-21507523 AGAAGTGACGAGGCAGATGAGGG + Intergenic
1146532755 17:33623902-33623924 CAGAGAGAGAAGGCAGAGGAGGG - Intronic
1147510404 17:41064204-41064226 AAGAGTGAAGAGGAAGATGATGG - Intergenic
1147745491 17:42691988-42692010 AACAGTGAGCAGGCAGACTGTGG + Exonic
1147890842 17:43715705-43715727 GAGAGTGAGGATGCACATGATGG - Intergenic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148393109 17:47287619-47287641 AAGATTGGCCAGGCATATGATGG + Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151995868 17:77608643-77608665 TAGAGGCAGAAGGCAGATGAGGG - Intergenic
1152377987 17:79928515-79928537 AAGAGGGAGCAGGCTGGGGAAGG - Intergenic
1152496976 17:80680094-80680116 AAGAGCCAGCAGGCTGAGGAGGG - Intronic
1153678333 18:7476186-7476208 CAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1155340877 18:24812831-24812853 AAGAATGAGCATACAGAGGAGGG + Intergenic
1155367482 18:25063292-25063314 AAGAGTTAGCTGGCTGATGATGG + Intronic
1155585774 18:27362624-27362646 CTGAATGAGAAGGCAGATGAAGG - Intergenic
1155741634 18:29296828-29296850 AAAAGAAAGCAGGCAGAAGAAGG - Intergenic
1155989882 18:32269443-32269465 GAGGGTGAGCAGGCCGGTGAGGG + Intronic
1156388583 18:36629085-36629107 AAGAGTGACCTGGCAGATAGTGG + Intronic
1156454925 18:37287527-37287549 AAGAGAGAGGAGGAAGAAGAGGG - Intronic
1159472025 18:68869199-68869221 AACAATGAGCAGAGAGATGATGG + Intronic
1159814009 18:73051593-73051615 AGGAGGGAGCAGGCAGAGGTGGG + Intergenic
1162300403 19:9841821-9841843 AAGAGTGAGCAGGAGGGTGCAGG + Intronic
1163811177 19:19432767-19432789 CAGAGTGAGCAGGCTGAAGTGGG + Intronic
1164612108 19:29639524-29639546 AAGAATAAACAGCCAGATGAAGG + Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1166347483 19:42175693-42175715 AAGAGGCAGCAGGCAGTCGAAGG + Intronic
1166379783 19:42349910-42349932 AAGGGTGAGGAGTCAGAAGATGG - Intronic
1166866822 19:45843648-45843670 AAGAATGAGCAGGCTGAGGCCGG + Intronic
1166886655 19:45965349-45965371 AAGAGAGAGGGGGCAGAAGATGG - Intronic
1166966895 19:46534260-46534282 AAGATCGAGGAGGCAGATGAGGG + Intronic
1167591589 19:50407113-50407135 ACGACTGAGCAGGTAGCTGAGGG - Exonic
1167811873 19:51840397-51840419 AAGTGGGAGCAGGCAGAGGGTGG + Intergenic
1167985008 19:53307238-53307260 GAGAGTGAGGAGGCAGCTGCTGG - Intergenic
925384005 2:3449330-3449352 AAGACTGGGCGGGCAGATGCAGG - Intronic
925489836 2:4378685-4378707 AAGATTGAGGAGGCAGAGAAGGG - Intergenic
925540049 2:4957017-4957039 TAGAGAAAGCAGGCAGAAGAAGG - Intergenic
925564011 2:5229869-5229891 AATAGTGAGTAGGCAGATGGAGG - Intergenic
926082052 2:9995186-9995208 AAGTGTGAGCAGGAAAATGCAGG - Intronic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927333173 2:21890285-21890307 AACAGTGGGCAGAGAGATGAAGG + Intergenic
928248849 2:29656946-29656968 AAAAGTGAGGAAGCAGAAGAGGG - Intronic
932190497 2:69737919-69737941 AAGTAAGAGCAGGCAGCTGAAGG - Intronic
932302472 2:70676906-70676928 AAGAGTGAGCTGGCTGTTCAGGG + Intronic
933971216 2:87471254-87471276 AAATGTGAGCAGGCAGCTGGGGG + Intergenic
934555014 2:95282479-95282501 GACAGTGAGCAGGAGGATGAGGG + Intronic
936166233 2:110122118-110122140 AAGTGTGCCCAGGCAGCTGATGG + Intergenic
936322512 2:111478935-111478957 AAATGTGAGCAGGCAGCTGGGGG - Intergenic
937074075 2:119088373-119088395 GAGAGTGAGCTGGAAGATCACGG - Intergenic
938195173 2:129320559-129320581 AAGAGAAAGCAGCCAGATGGGGG - Intergenic
938713004 2:133991751-133991773 AAGAGTGAGCAGGAATCTAAGGG + Intergenic
938881154 2:135590778-135590800 TAGAGTATGAAGGCAGATGATGG + Intronic
939306998 2:140425181-140425203 AACAGTGAGGAGGCATAGGATGG - Intronic
940192002 2:151050987-151051009 AATGGTGGGCAGGCAGATAAAGG - Intergenic
942184575 2:173412782-173412804 CAGATTGAGAAGGCAGATGCTGG + Intergenic
942274079 2:174305776-174305798 AACAGTGAGCAAGCAGAAGAAGG - Intergenic
942276663 2:174328252-174328274 AAGAGGGAGGAGGAAGAGGAGGG + Intergenic
942893278 2:181017922-181017944 AAGACTGAGCTGGAAGATGATGG - Intronic
943345885 2:186736221-186736243 GAGAGTAACCAGGCAGATGTAGG + Intronic
944917185 2:204373155-204373177 TAAAGTGAGTAGGAAGATGAGGG - Intergenic
945974386 2:216259205-216259227 CAGAGGGAGCAGGCAGAGGGTGG - Exonic
946066055 2:216988145-216988167 AAAAGTAAGCATGAAGATGATGG - Intergenic
946924869 2:224616558-224616580 CAGAGGGAGTAGGGAGATGAGGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948305889 2:236946451-236946473 GAAACTGAGTAGGCAGATGAAGG - Intergenic
948662007 2:239513362-239513384 AAGGGGGAGCAGGCAGGCGAAGG - Intergenic
948887636 2:240892126-240892148 CAGAGTGAGCAGGCTCAGGAAGG - Intronic
948930416 2:241128318-241128340 AAGAGAGAGGAGGCTGGTGAGGG + Intronic
1168737194 20:151137-151159 CAGAGTGAGAAGGCAGTTTATGG - Intergenic
1168789178 20:564438-564460 AAGAGAGTGAAGGAAGATGAGGG + Intergenic
1168808786 20:689159-689181 AAGATGGAGCAGGCAGGGGAGGG + Intergenic
1169264774 20:4161159-4161181 AGGTGTGAGCTGGCAGCTGAGGG - Intronic
1169465405 20:5833801-5833823 AAGAGAGAGGGGGCAGGTGAGGG + Intronic
1170828830 20:19821688-19821710 AAGGATGAGTAGGCAGACGAAGG - Intergenic
1173246795 20:41342648-41342670 AATGCTGAGCAGGCAGATGTGGG + Intronic
1173246807 20:41342693-41342715 AATGCTGAGCAGGCAGATGTGGG + Intronic
1175238325 20:57527428-57527450 AAGGGTGAGGAGGCAGCCGATGG + Intergenic
1175807505 20:61838011-61838033 AACGGTGAGCAGGCAGAGAAAGG - Intronic
1176249379 20:64113000-64113022 CAGAGTGGGCAGGCAGGTGCAGG + Intergenic
1176675550 21:9773957-9773979 AAGTGTGCTCAGGCACATGAAGG + Intergenic
1177067414 21:16457695-16457717 ATGAGTTGCCAGGCAGATGAAGG + Intergenic
1177816867 21:25987267-25987289 ATGAGTGAGCAGGCTGAAGGAGG - Intronic
1179304516 21:40142111-40142133 AAGAGTGCCCAGGCACATGGAGG - Intronic
1179320776 21:40289228-40289250 AAGAGCATGCAGGAAGATGAGGG + Intronic
1179719928 21:43309393-43309415 AGGCGTGAGCAGGCAAAAGATGG - Intergenic
1180607477 22:17070073-17070095 AAGAGGGAGCAAGCAAATCATGG + Intergenic
1182053045 22:27327867-27327889 AAGACCCAGCAGGCTGATGAGGG + Intergenic
1183064890 22:35356013-35356035 AAGAGAGAGAAGGCAGGAGAGGG + Intergenic
1183269441 22:36851481-36851503 GACAATGAGCAGGCAGAGGAAGG + Intergenic
1183402514 22:37612993-37613015 ATGAATGAGCAGTCAGCTGAGGG - Intronic
949272585 3:2236871-2236893 TAGAATGAGTAGGCAGAAGACGG + Intronic
949590517 3:5489552-5489574 TGAAGTGGGCAGGCAGATGAAGG + Intergenic
951049852 3:18082086-18082108 AGTTGTGAACAGGCAGATGAAGG + Intronic
953005196 3:38971416-38971438 AAGAGCAAGCAGGCAGGTAAAGG + Intergenic
953487690 3:43317712-43317734 AAGAGTGGCTAGGCAGAGGAGGG - Intronic
954899795 3:54008929-54008951 AAGCCTGAGCAGGCAGAGGTGGG - Intergenic
955347442 3:58171605-58171627 AAGACTGCCCAGGCTGATGAAGG - Intronic
955989967 3:64616051-64616073 AAGACTGAGAAGGTTGATGATGG - Exonic
956497563 3:69844671-69844693 AAGAGTGAACAGGCAACTTATGG + Intronic
956702650 3:71972285-71972307 GAGAGCGAGCAGGCAGATGGTGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
962061933 3:131937881-131937903 AAGAGAGAGGAAGCAGAAGAGGG + Intronic
962697679 3:137967073-137967095 AAGAGTGAGCAGAAAAATCATGG - Intergenic
962932860 3:140053646-140053668 GAGAGAGAGGAGGGAGATGAGGG - Intronic
964867977 3:161282547-161282569 AAGATAAAGCAGGCAGAAGAAGG - Intergenic
965160494 3:165127622-165127644 AAGATTGAGCATGCAGATTATGG + Intergenic
965867377 3:173221288-173221310 AAGTGTGAGTAGGCTGATTAGGG + Intergenic
966805336 3:183803340-183803362 CAGAGTGGACAGGCAGATGTGGG - Intronic
967978411 3:195048492-195048514 AAGAGTGAGCAGACTGATACTGG + Intergenic
968443461 4:636275-636297 ACGAGTGAGCAGGGAGCAGAGGG + Intronic
968486932 4:867333-867355 GAGAGTGAGGTGTCAGATGAAGG - Exonic
968881595 4:3303056-3303078 ATGAGTGAGCAGGAAAATCATGG + Intronic
968914403 4:3491000-3491022 ATGAATGAGCAGGAAGAAGAAGG - Intronic
969246648 4:5938906-5938928 AAGCATGAGCAGGCAGAGGAAGG - Intronic
970565762 4:17331036-17331058 AAAAGTGAGTAGGAAGATGGAGG - Intergenic
970942179 4:21647667-21647689 ACTAGTTAGCAGGAAGATGAGGG - Intronic
971776342 4:30970743-30970765 TAGATTCATCAGGCAGATGAAGG + Intronic
972167986 4:36310863-36310885 AAGAGAGAGGAGGGAGAGGAAGG + Intronic
973607242 4:52600032-52600054 AGGAATAAGCAGGGAGATGAGGG - Intronic
973735195 4:53864651-53864673 AAGTTTGAGTAGGAAGATGAAGG + Intronic
974226273 4:59049544-59049566 AAGAGTGAAGAGGAAGCTGAAGG + Intergenic
974699530 4:65422440-65422462 AAGGTTGAGCAGGCAGAGAATGG - Intronic
975294132 4:72712513-72712535 CAGAATTAGCAGTCAGATGAGGG - Intergenic
976124478 4:81818941-81818963 AAGAGTGAGAAGGGAGTTGTTGG + Intronic
978406403 4:108383552-108383574 AAGAGTGAGCAGAAAAATCATGG + Intergenic
980221278 4:129919283-129919305 AAGAGGGAGCAGGCATGTCATGG + Intergenic
980626041 4:135375839-135375861 AAGAGTGAACAGGCAACTTACGG - Intergenic
981462150 4:145025888-145025910 CAGTGTGAGCAGGCAGTTGATGG + Intronic
981554677 4:145979788-145979810 TACAGTGAGCAAGCAAATGAAGG + Intergenic
981778003 4:148392636-148392658 AAGACTGAGAAGGCAGGTCAAGG + Intronic
982417445 4:155152458-155152480 AAGATGGAACAGGCAGTTGATGG - Intergenic
985399993 4:189584740-189584762 AAGTGTGCGCAGGCACATGAAGG - Intergenic
985703727 5:1388751-1388773 ATGGATGGGCAGGCAGATGATGG - Intergenic
986740300 5:10699951-10699973 CAAAGTGAGGAGGCAGATGCTGG + Intronic
986775072 5:11006768-11006790 GAAAGTGAGAAGGCAGAAGATGG + Intronic
988665836 5:33326470-33326492 AAGAGAGAGCAGGCAGAGCAAGG - Intergenic
989187471 5:38638985-38639007 AGGCATGAGCAGGCAGAAGAGGG - Intergenic
989270175 5:39523840-39523862 AAGAAGGAGCATGCAAATGACGG + Intergenic
989468536 5:41786402-41786424 AACAGTGAGCTGGAAGAGGAGGG + Intronic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990358503 5:54995145-54995167 AAGATTAAGCAGGTGGATGAAGG - Intronic
990514625 5:56519885-56519907 GAGACTGAGCAGGCAGGAGAGGG - Intronic
991199218 5:63971615-63971637 CAGAGTGATCAGGCAGTTTACGG - Intergenic
992084987 5:73270243-73270265 AACAGGCAGAAGGCAGATGAAGG - Intergenic
994413800 5:99442566-99442588 AAGGGTCATCAGGAAGATGATGG - Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
995197459 5:109388138-109388160 AAGAGTGAGCAGAGAAATTAAGG - Intronic
995517438 5:112968099-112968121 AAGAGTGATCAGGCTGGGGATGG - Intergenic
996300562 5:121978891-121978913 AAGAGGTAGCAGGCAGAACAAGG - Intronic
996330228 5:122320409-122320431 AGCAGTGAGCAGACAGATGTGGG + Intronic
996391897 5:122971257-122971279 AAGATAAAGCAGGCAGAAGAAGG - Intronic
996647066 5:125829032-125829054 CAGAGTGAGCAGGTAGATCAGGG - Intergenic
997373294 5:133376951-133376973 GAGAGGGAGCAAGCAGATCATGG - Intronic
997904217 5:137798725-137798747 AAGAATTAGCAGACAGATCAAGG - Intergenic
997974846 5:138435045-138435067 AAAAGTGAACAGGCATATTAAGG - Intronic
998170321 5:139868808-139868830 GAGGATGAGCAGGCAGATGGAGG + Intronic
998232960 5:140373142-140373164 AAGAGTGGGAAGGAAGAGGAAGG + Intronic
998545770 5:143026318-143026340 AAGAGTAAGCAAGTAGATAAAGG + Intronic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
1000862551 5:166474136-166474158 AAAAGTGAGCAGGCAAACAATGG + Intergenic
1003334701 6:5159432-5159454 GAGAGTGATCATGCAGAAGAAGG + Intronic
1003393673 6:5734553-5734575 GAGAGGGAGCAAGGAGATGATGG + Intronic
1004918823 6:20357236-20357258 AACAGTGAGCAGGAAAATGCTGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006621867 6:35370913-35370935 AAGAATGAGCAGCCAGCTGCTGG - Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006925825 6:37654663-37654685 AAGACGGAGCAGGAAGAGGAGGG + Intronic
1007601311 6:43083361-43083383 AAGAAGGACCAGGCAGATGGGGG - Intronic
1007873806 6:45071472-45071494 AAGAGTCAGCAGCCAGAAAAGGG + Intronic
1011038006 6:82999100-82999122 AAGAGGGAGGAGGCACAAGAGGG - Intronic
1011129445 6:84038190-84038212 AGGAATGAGCAGCCAGCTGAAGG + Intronic
1011494263 6:87923165-87923187 AGGAGGGAGCAGACAGGTGAAGG - Intergenic
1011775123 6:90721609-90721631 AAGAGTGAGGAGGGAAGTGAAGG + Intergenic
1011935018 6:92765967-92765989 AAGGGTGAGTATGCAGAGGAGGG - Intergenic
1011949012 6:92940983-92941005 AAGTCTGAGCAGCCTGATGAAGG - Intergenic
1011980737 6:93374264-93374286 AGGAGTGGGAAGACAGATGAGGG - Intronic
1012962911 6:105641570-105641592 AAGAGTGAACAGAAAAATGATGG - Intergenic
1012988093 6:105896619-105896641 GAGAGGGTGCTGGCAGATGAAGG + Intergenic
1014659769 6:124155481-124155503 AAGAATGAACAGGCCAATGAAGG + Intronic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015241074 6:131024214-131024236 AAGAGAAAGCAGGCAGAGGGAGG + Intronic
1015528810 6:134200248-134200270 AAGTGTGAGCAGTAAGATGACGG + Intronic
1015651465 6:135466036-135466058 AAAAGTGAGAAGGCAAATGAGGG - Exonic
1015728614 6:136325074-136325096 GAGAGTGAGAAGGAAGAGGAAGG + Intergenic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1018038068 6:159898626-159898648 AAGAGGGAGGAGGAAGAAGAGGG - Intergenic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1018478958 6:164170970-164170992 TGGAATGAGCAGGCACATGACGG + Intergenic
1018733378 6:166669672-166669694 GAGAGTGAGCTGGCAGGGGATGG - Intronic
1019173038 6:170145507-170145529 AGGAGAGAGCAGGGAGAGGAGGG + Intergenic
1019517421 7:1446182-1446204 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019517478 7:1446326-1446348 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019517517 7:1446432-1446454 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019986466 7:4659922-4659944 AAGAGTGGGCTGGCAGGTGCTGG - Intergenic
1021475635 7:21057722-21057744 CAGAGTGTGCAGGCAGTTGCAGG - Intergenic
1022037812 7:26550584-26550606 AAGAGGGAGGAGGAAGAAGAAGG + Intergenic
1023719749 7:43080512-43080534 AAGAGTAAGCATGGTGATGATGG + Intergenic
1024471612 7:49773078-49773100 AAGAGAGAGCAGGCAGAAAGAGG + Intergenic
1026651103 7:72216609-72216631 AGGAGTGAGAAGGCAGGTGAAGG - Intronic
1029375710 7:100175949-100175971 AAAAGTGAACAGGCAGAGGCAGG + Intronic
1031120869 7:117720173-117720195 AAGAGAGAGAAGGGAGATGAAGG - Intronic
1031857445 7:126939517-126939539 AAGAGTAAGCATTCAGATAATGG + Intronic
1031864087 7:127018471-127018493 AAGTGTAAGCAGGCAGTTCAGGG + Intronic
1033280168 7:140000934-140000956 TAGAGTGAACAAGAAGATGAAGG - Intronic
1033305358 7:140221561-140221583 CAGAGTGAGCAGGAAGTTGCTGG - Intergenic
1033426519 7:141249550-141249572 AAGAGTGAGAGGGCAGAAGAAGG + Intronic
1033588046 7:142788737-142788759 GGGAGTGAGGAGGCAGATTATGG - Intergenic
1033599516 7:142878536-142878558 AAGGTTGAGTAGGCAGAGGATGG - Intronic
1033669621 7:143478576-143478598 AAGAATGAGGAAGGAGATGAGGG - Exonic
1035211880 7:157335098-157335120 AAGAGAGGGGAGGCAGATGCAGG + Intergenic
1036127177 8:6073990-6074012 AAGAGTAAGCAGTAAAATGAAGG + Intergenic
1036595140 8:10205223-10205245 AAGAGTTAGAAGGCAGATGTCGG + Intronic
1036727154 8:11230444-11230466 AGGAGTTAGCAGGCAGAGGAAGG + Intergenic
1036926349 8:12909612-12909634 ATGAGAGTGCAGGCAGATAAGGG - Intergenic
1037362266 8:18085649-18085671 AAGTTTGAGCAGACAGTTGAGGG + Intergenic
1037723740 8:21466511-21466533 TAGAGTGAGCGAGCAGATGAAGG - Intergenic
1038363224 8:26904296-26904318 AAAAGTGAGCAGGAATTTGAAGG + Intergenic
1039395473 8:37221981-37222003 AAGAGTAAGAAAGCAGATGAAGG + Intergenic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1040792636 8:51250658-51250680 AAGAGTGAGCTGGCAGGGCATGG - Intergenic
1040857321 8:51961529-51961551 AAGAGAGAGTAGACAGAAGAAGG + Intergenic
1041085574 8:54253416-54253438 AAGAGGGAGATGGCAGAAGATGG + Intergenic
1041115256 8:54529740-54529762 AAGATTGAGCATGTACATGAAGG - Intergenic
1041388762 8:57330670-57330692 AAGAGTGAGTAGGCTGACCAAGG - Intergenic
1041607689 8:59802561-59802583 AAGAGTTAGCAGGATGATAAAGG - Intergenic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1044090321 8:87992511-87992533 GAGAGGGAGGAGGCAGAAGAGGG - Intergenic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1046645766 8:116783795-116783817 CAGCATGAGCAGGCAGAAGAGGG - Intronic
1047633792 8:126737170-126737192 AAGAGTGATAAGGCACAGGATGG - Intergenic
1047792419 8:128217813-128217835 AATCGTGAGCAGACGGATGAAGG - Intergenic
1048250735 8:132864796-132864818 AAGAGTGAGGATGCAGAGGAGGG + Intergenic
1048509323 8:135048291-135048313 AAGATTGTGCAGGCAGAGCATGG - Intergenic
1049566620 8:143343560-143343582 AAGAGTGGGCAGGCAGTAAAAGG + Intronic
1050723083 9:8613305-8613327 AAGAGAGAGCAGGAAGGGGAAGG + Intronic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052528364 9:29650619-29650641 AGGAGTAAGCAGGCAGGAGAAGG - Intergenic
1052897318 9:33759875-33759897 ATTAGTGAGCAGGCAGAGGCTGG - Intronic
1052938113 9:34110395-34110417 ATGAGTGAGGAAGCAGAGGAAGG - Intronic
1053616033 9:39766754-39766776 GACCGTCAGCAGGCAGATGAAGG - Intergenic
1053874206 9:42526064-42526086 GACCGTCAGCAGGCAGATGAAGG - Intergenic
1053898414 9:42768521-42768543 GACCGTCAGCAGGCAGATGAAGG + Intergenic
1054237484 9:62575636-62575658 GACCGTCAGCAGGCAGATGAAGG + Intergenic
1054268127 9:62940690-62940712 GACCGTCAGCAGGCAGATGAAGG + Intergenic
1054551620 9:66610147-66610169 GACCGTCAGCAGGCAGATGAAGG + Intergenic
1056071570 9:82992620-82992642 GAGAGGGAGGAGGAAGATGATGG + Intronic
1056812794 9:89777289-89777311 GAGAGTGAGCTGACAGCTGAAGG - Intergenic
1057294033 9:93825105-93825127 AAGAAGGAGCAGGCAGGTGGGGG - Intergenic
1060182107 9:121541494-121541516 AGCAGGGAGGAGGCAGATGAGGG - Intergenic
1060667380 9:125439933-125439955 AAGAGTGAGCGGGCTTTTGAGGG + Intronic
1061378643 9:130241184-130241206 AAGAGGGAAAAGGCAGAAGACGG - Intergenic
1061945124 9:133904481-133904503 ATGAGTGAGCAGGCTCAGGACGG + Intronic
1061972554 9:134052844-134052866 AAAAATGAGCATGCAGATGAGGG + Intronic
1062718149 9:138021483-138021505 AAGACAGAGCAGCCAGATGTGGG - Intronic
1186499324 X:10038687-10038709 AACAGGGAGCAGGAAGCTGATGG - Intronic
1186948249 X:14593496-14593518 AAACTTGAGCAGTCAGATGAAGG + Intronic
1187768343 X:22667827-22667849 AAGGAGGAGCAGGCAGATGATGG - Intergenic
1188302698 X:28525211-28525233 AAGAATAAGCAGGCAGATCAGGG + Intergenic
1188520594 X:31033689-31033711 AAGAATGAAGAGGCAGGTGAGGG - Intergenic
1189592417 X:42529239-42529261 AAGAGAGAAGAGGCAGATGTAGG - Intergenic
1189716057 X:43867249-43867271 AAGAAGGAGCAGGCAAAGGAAGG + Intronic
1190427263 X:50345310-50345332 AAGAGGGAGCCAGCAGGTGAGGG - Intronic
1192473740 X:71420972-71420994 AAGAGTGAGCAGGCGGCAGCGGG - Intronic
1192484671 X:71514729-71514751 AAGAGTCGGGAGGGAGATGATGG + Intronic
1194147629 X:90282326-90282348 AAGAGTCAGCAGACAGAGGAAGG + Intergenic
1195863222 X:109403192-109403214 AAGAAGGAGCAGATAGATGAGGG - Intronic
1197966027 X:132062689-132062711 AAGAATGAGGAGGTAAATGAGGG - Intergenic
1198116782 X:133551853-133551875 AAGAGGGTGCAGGCAGGTGCTGG - Intronic
1200110394 X:153737941-153737963 GCGAGTGGGCAGGCAGCTGAGGG + Intronic
1200367626 X:155684118-155684140 GAGAGTGAGAAGTGAGATGATGG + Intergenic
1200494021 Y:3859083-3859105 AAGAGTCAACAGACAGAGGAAGG + Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic