ID: 1044021741

View in Genome Browser
Species Human (GRCh38)
Location 8:87113202-87113224
Sequence CAGTGTGAGCCATGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044021734_1044021741 28 Left 1044021734 8:87113151-87113173 CCTGGGCAAGAGGCTAATGCCAG 0: 1
1: 0
2: 3
3: 13
4: 228
Right 1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG No data
1044021733_1044021741 29 Left 1044021733 8:87113150-87113172 CCCTGGGCAAGAGGCTAATGCCA 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG No data
1044021737_1044021741 9 Left 1044021737 8:87113170-87113192 CCAGTCAAGGGCAATTCTTCAGA 0: 1
1: 0
2: 1
3: 16
4: 262
Right 1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044021741 Original CRISPR CAGTGTGAGCCATGGGCAGT AGG Intronic
No off target data available for this crispr