ID: 1044025808

View in Genome Browser
Species Human (GRCh38)
Location 8:87170678-87170700
Sequence AGCTGGGTATACAAGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044025808_1044025812 1 Left 1044025808 8:87170678-87170700 CCAGTTTCCTTGTATACCCAGCT 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1044025812 8:87170702-87170724 TTTGAGTATACCTATCTTGAAGG No data
1044025808_1044025813 2 Left 1044025808 8:87170678-87170700 CCAGTTTCCTTGTATACCCAGCT 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1044025813 8:87170703-87170725 TTGAGTATACCTATCTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044025808 Original CRISPR AGCTGGGTATACAAGGAAAC TGG (reversed) Intronic
902849925 1:19147042-19147064 AGCTGGGTACAAAAGCAAAGAGG + Intronic
903541306 1:24097853-24097875 AGCTGGGCAGACAAGGACATGGG - Intronic
907505439 1:54914798-54914820 AGCTGGGTATAGAGGGACAATGG + Intergenic
907940049 1:59078906-59078928 AGCTGGTTATATAGGGAAATAGG - Intergenic
908277639 1:62492085-62492107 AGCTGGGAATACAGGGGCACAGG - Intronic
910591193 1:88929306-88929328 AGCTGGGTATAGAGGGACAACGG - Intergenic
911429877 1:97772150-97772172 ATCAGGGAATACAAGGAAAATGG + Intronic
912190626 1:107335407-107335429 AGCTGAGGAGACATGGAAACAGG + Intronic
912681243 1:111730294-111730316 AGTTGGGAAGACAAGGAAAGTGG - Intronic
913250490 1:116909339-116909361 AGCTGGGTAAGGAAGGAGACAGG + Intergenic
915405352 1:155656015-155656037 AGCATGGTATACTGGGAAACTGG - Intergenic
917223550 1:172757718-172757740 AGCTAGGTACACAAAGAAACAGG - Intergenic
917651085 1:177078039-177078061 AGCTGGAGAGACAAGGAAATAGG + Intronic
919592249 1:199519528-199519550 AGCTTGGTATGCAATGAACCTGG - Intergenic
920686714 1:208114450-208114472 AGCTATGTACACAAGGAAGCAGG + Intronic
921092585 1:211857698-211857720 AGCTGGGTATAGAGGGACAACGG + Intergenic
921427566 1:215022016-215022038 AGCTGGAGAACCAAGGAAACTGG - Intronic
922069403 1:222176034-222176056 AGCTGGACTTACAAGGAAAAAGG + Intergenic
924365958 1:243294172-243294194 AACAAGGAATACAAGGAAACAGG - Intronic
1063317778 10:5023008-5023030 AGCATGGCACACAAGGAAACAGG - Intronic
1068428902 10:56907183-56907205 AGCTGGGAATACAGGAATACAGG + Intergenic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1074856557 10:117478305-117478327 ACCTGGGTATAAAAGAACACAGG - Intergenic
1078089145 11:8253150-8253172 AGCTGGGCAGACGAGGAAAGTGG + Intronic
1078485912 11:11723069-11723091 AGCAGGGTATACAGGGAATTTGG - Intergenic
1079723679 11:23851554-23851576 AGCTGTGTAGACAAGGAAAGAGG - Intergenic
1081263629 11:40991718-40991740 AACTGTGTATACCAGGAATCTGG - Intronic
1085158067 11:74314261-74314283 AGCTGGAAAGGCAAGGAAACAGG + Intergenic
1086441839 11:86836142-86836164 AGCTGGGTATAGAGGGACAAGGG + Intronic
1091766058 12:3120601-3120623 CGCTGGGCATAAAAGGAAAGAGG - Intronic
1091980091 12:4857758-4857780 TGCTAGGTCTCCAAGGAAACAGG + Intergenic
1092294219 12:7185355-7185377 AGCTGGGTATAGAGGGACAACGG - Intergenic
1092469295 12:8764012-8764034 AGCTGGGTATAGAGGGACAACGG + Intronic
1093620429 12:21282415-21282437 AACTGGGTATAAAAGGAACATGG + Intronic
1094604939 12:31941870-31941892 AGCATGGTATACTGGGAAACCGG - Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1098322919 12:69266227-69266249 ACATGGGAAAACAAGGAAACAGG - Intronic
1098780049 12:74675956-74675978 GGCTGGGTAGACAAGAAAACAGG + Intergenic
1098871591 12:75822877-75822899 AGCTGGAAATACAAAGAAAATGG + Intergenic
1103803254 12:123553306-123553328 AGCTGGGTATATAGGGACAATGG - Intergenic
1103967768 12:124651114-124651136 AGCTGTGTTCACAGGGAAACGGG + Intergenic
1104851390 12:131876516-131876538 AGCTGGGTATAGAGGGACAGTGG + Intergenic
1106676795 13:31968387-31968409 ATCTGTGTATAGAGGGAAACTGG - Intergenic
1107410222 13:40151420-40151442 AACTGAATACACAAGGAAACAGG - Intergenic
1110475908 13:75913124-75913146 AGATGGGTTTCCAAGGAAAAGGG + Intergenic
1115323566 14:32112164-32112186 AGCTGTGGAAACAAGAAAACTGG - Intronic
1115825590 14:37269031-37269053 AGATATGTATACAAGGAACCAGG - Intronic
1116251388 14:42487429-42487451 AGATGGGTAAAGAAGGAAAAAGG + Intergenic
1117078654 14:52129068-52129090 AGCTGTGTATAGAATGAAAAAGG - Intergenic
1120720083 14:87881113-87881135 AGCTGGGTCTTCAGGGAGACAGG - Intronic
1121057264 14:90867927-90867949 AGCTGGGCATACAAAGAAAAGGG + Exonic
1122161402 14:99786857-99786879 GGCTGGGTAAACCAGGACACAGG + Intronic
1124204493 15:27705267-27705289 AGCTGGGTTGCCAAGGCAACAGG - Intergenic
1130093153 15:80837930-80837952 AGATGGGTAAACAAGGAAGTTGG - Intronic
1130240080 15:82179800-82179822 GGCTGGGTATGCACAGAAACGGG + Intronic
1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG + Intronic
1134239952 16:12498312-12498334 AGCTAAGCATACAAGGTAACTGG - Intronic
1138814928 16:60193110-60193132 AGATGGCTATTCAGGGAAACAGG + Intergenic
1139000962 16:62509334-62509356 ATTAGGGTATACATGGAAACAGG + Intergenic
1139338788 16:66253481-66253503 AACTGGTTATACAAGTAAAATGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144783537 17:17819635-17819657 ACCTGGGTGTGCAAGGAGACGGG + Exonic
1148205812 17:45779125-45779147 AGCTGGGTATTGAAGGAAGTGGG - Intergenic
1149273934 17:55013982-55014004 AGCTGGGTATAGAGGGACAACGG + Intronic
1153401699 18:4689456-4689478 AGCTGGGTATAGAGGGACAATGG - Intergenic
1153483613 18:5572971-5572993 AGCTGGGCATAAAAGGAATAAGG + Intronic
1156675290 18:39520596-39520618 AGCTGGGAATACAGGCATACAGG - Intergenic
1158973409 18:62688874-62688896 ACCTTGGTCTACAAGGCAACAGG - Intergenic
1159474000 18:68893869-68893891 AACATGGTATAAAAGGAAACTGG - Intronic
1163181317 19:15605959-15605981 AGCTGAGTGAACAAGGAAAAAGG + Intergenic
1164159442 19:22617062-22617084 AGATGGGAACACCAGGAAACTGG - Intergenic
1164173708 19:22749485-22749507 AGCTGGGTATAGAGGGACAACGG - Intergenic
1165460910 19:35943882-35943904 AGTTGGGTATAAAATGAAACCGG + Intronic
924973984 2:156535-156557 AGCTGGGTATAGAGGAAAAACGG + Intergenic
926044649 2:9701118-9701140 ACCTGAGTACACAAGGCAACAGG - Intergenic
928064365 2:28148444-28148466 AGTTGGGTTACCAAGGAAACTGG + Intronic
928347997 2:30518647-30518669 AGCTGGGTATAGAGGGACAACGG - Intronic
928453129 2:31396844-31396866 GGGTGGGTAAACAAGGAGACAGG - Intronic
928677197 2:33661571-33661593 AGCTGGGTATAGAGGGACAACGG - Intergenic
929480327 2:42300478-42300500 CTATGGGTATACAAGAAAACTGG + Intronic
929629911 2:43448921-43448943 TGCTAGGCATACAAAGAAACAGG + Intronic
929742515 2:44618034-44618056 AGAAGTGTATACAAAGAAACAGG - Intronic
930810389 2:55534447-55534469 AACTGGGGAAACAAGGAGACCGG - Intronic
932629140 2:73323320-73323342 AGATGGGCATACAAGGAAAGTGG + Intergenic
934576211 2:95403021-95403043 AGCTGGGCATATGGGGAAACTGG + Intronic
934638400 2:96010880-96010902 AGCTGGGCATATGGGGAAACTGG + Intergenic
934795255 2:97094531-97094553 AGCTGGGCATATGGGGAAACTGG - Intronic
935748840 2:106212761-106212783 AGCTGGGTATAGAGGGACAATGG - Intergenic
941232078 2:162923361-162923383 AGCGAGGTATGAAAGGAAACTGG + Intergenic
941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG + Intronic
944859962 2:203806266-203806288 TACTGGGTATGCAAAGAAACAGG - Intergenic
945695124 2:213092599-213092621 AGCTGGGCACCAAAGGAAACAGG - Intronic
945964448 2:216170985-216171007 AGCTGGTTGAAAAAGGAAACCGG + Intronic
946050940 2:216862006-216862028 TGGTGGCTATACAAGGAATCTGG - Intergenic
948890816 2:240906267-240906289 AGCTGGGTTTCCCTGGAAACAGG - Intergenic
1170256887 20:14354781-14354803 ACCTGGGAATACACAGAAACTGG - Intronic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1174977264 20:55349629-55349651 AGCTGGGTATAGAGGGACAATGG - Intergenic
1175028085 20:55924276-55924298 AGGTGGCTATTTAAGGAAACAGG + Intergenic
1176018517 20:62951134-62951156 ACCTGGGTTTTCAAGGACACAGG - Intergenic
1177263360 21:18755758-18755780 AGCTGGGTATAGAGGGACAACGG + Intergenic
1179066493 21:38029319-38029341 AGTTTGGTAAATAAGGAAACCGG + Intronic
1181042554 22:20199088-20199110 AGCTGAGTCTCCAAGGAAGCTGG - Intergenic
1184697802 22:46149882-46149904 AGCTGGGAGGACAAGGAAACAGG - Intergenic
949526566 3:4910462-4910484 AGAGAGGTAGACAAGGAAACAGG + Intergenic
950832231 3:15886203-15886225 AGCTGGATACCCAGGGAAACTGG - Intergenic
951336512 3:21429112-21429134 AGATAGGTAAACAAGAAAACTGG + Intronic
951838072 3:27003998-27004020 AGCTGGGTATAGAGGGACAATGG - Intergenic
954413903 3:50383638-50383660 AGCTGGGGATATAAGGAAGGGGG - Intronic
955330001 3:58039519-58039541 AGCTGGGAAAACAAGGCAAGGGG - Intronic
956160408 3:66345535-66345557 AGATGGGTAAAAAAGGAAGCAGG - Intronic
958016090 3:87941806-87941828 AGCTGGGTATAGAGGGACAATGG + Intergenic
958047712 3:88305009-88305031 AGCTGGACATACAAGGCAAAGGG - Intergenic
961514238 3:127422905-127422927 GGCTGGGTTTCCTAGGAAACAGG + Intergenic
962479011 3:135782421-135782443 AGCTGAGAGTCCAAGGAAACTGG - Intergenic
962735466 3:138321697-138321719 AGCTGGGTATAGGAGGAATGAGG + Intronic
964880872 3:161421283-161421305 AGCAGGGAACACAAGGGAACTGG + Intergenic
965054645 3:163697493-163697515 AGCTGGGTATAGAGGGACAATGG + Intergenic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
972450770 4:39196124-39196146 AACTGGGTGTCCAAAGAAACAGG - Intronic
972703865 4:41521069-41521091 AGGTGGGAATAAAAGGAAAATGG - Intronic
973231478 4:47844027-47844049 AGTAGGGGATACAAGGACACTGG - Intergenic
973765219 4:54156047-54156069 AGCTGGTTGTTTAAGGAAACTGG - Intronic
973937776 4:55866798-55866820 AGCTGGGTAGAAAAGTAAACAGG - Intronic
974155943 4:58072657-58072679 AGCTGTGTACACAAGGAGGCCGG + Intergenic
975313656 4:72929113-72929135 AGCTGGGTATAGAGGGACAACGG + Intergenic
975383922 4:73733126-73733148 AGCTGGATATAAAAGCAAAATGG - Intergenic
977130622 4:93231880-93231902 AGTTGGGTTCTCAAGGAAACAGG - Intronic
977367289 4:96086418-96086440 ATGTGGGTATAAAAGGCAACAGG + Intergenic
978586640 4:110281773-110281795 AGCTGGGTATAGAGGGACAACGG + Intergenic
980444368 4:132886547-132886569 AGCTGGGTATAGAGGGACAATGG - Intergenic
985421753 4:189791406-189791428 AGCGAGGTAAACAAAGAAACTGG - Intergenic
989136071 5:38156300-38156322 AGTTGAGAATAGAAGGAAACAGG - Intergenic
990398451 5:55409444-55409466 AGTTGTGTATATAAGGAAATTGG + Intronic
990410098 5:55533963-55533985 GTCTGGGCAGACAAGGAAACAGG + Intronic
990892441 5:60663434-60663456 AGCTGGGTATAGAGGGACAACGG - Intronic
992341285 5:75826082-75826104 AGCTAGGAATACAAAGAAATAGG - Intergenic
994404777 5:99331225-99331247 AGCTGGGCAAACACAGAAACAGG - Intergenic
1000721593 5:164714846-164714868 AGCTAGCTATAAAAGGAATCTGG + Intergenic
1006107276 6:31724138-31724160 AGCTGGGGATACACGGACCCTGG - Exonic
1006423346 6:33949047-33949069 AGCTTGACAGACAAGGAAACAGG + Intergenic
1006424953 6:33958163-33958185 TGCTGGGTGTACAAAGAAATGGG + Intergenic
1007640515 6:43335552-43335574 AGCTCTGTACATAAGGAAACAGG + Intronic
1008384316 6:50871004-50871026 TTCTGGGTTTAAAAGGAAACGGG - Intergenic
1009544945 6:65009384-65009406 AGCTGGGTATAGAGGGACAATGG - Intronic
1011076937 6:83447808-83447830 AGCTGGGTATAGAGGGACAACGG - Intergenic
1011900821 6:92294524-92294546 ACCTGGTTATACAAAGAATCAGG + Intergenic
1013543705 6:111135473-111135495 AGCTGGGTATAGAGGGACAATGG - Intronic
1013856540 6:114580403-114580425 TGCTGGGGATACAAGAAAAATGG + Intergenic
1016343092 6:143083539-143083561 AGCTGGGTATAGAGGGACAATGG + Intronic
1018577886 6:165278443-165278465 AGCTGGATATAGAGGGAAAGGGG - Intergenic
1018739635 6:166717512-166717534 AGCTGGGGTTCCAAGGAAACTGG + Intronic
1018761202 6:166895684-166895706 AGCTGGGTATAGAGGGACAATGG - Intronic
1020601532 7:10280222-10280244 AGCTTGGTATAGAAGGAAAATGG - Intergenic
1023700860 7:42890906-42890928 AGCTGGGTATAGAGGGTCACAGG - Intergenic
1024401927 7:48934008-48934030 AGCTTGGTATAAAGAGAAACAGG + Intergenic
1024487671 7:49937789-49937811 AGCTGGGGAAACAGGGAAATGGG - Intronic
1028145795 7:87318822-87318844 TGCTGGTGATACAAGCAAACAGG - Intergenic
1028300137 7:89188961-89188983 AGGTGGCTATACCAGGCAACCGG + Intronic
1028641980 7:93052568-93052590 AGGAGGGTATTCATGGAAACTGG + Intergenic
1029998124 7:105029629-105029651 GGCTGGATATAATAGGAAACTGG + Intronic
1030337454 7:108341880-108341902 AGCTGGGTATAGAGGGACAACGG - Intronic
1031847107 7:126819073-126819095 GGCTGGGTAGACACAGAAACGGG - Intronic
1032729386 7:134622871-134622893 AGTTGCGTTTACAAGGAAATTGG + Intergenic
1035411449 7:158646086-158646108 AGCTGCGTATTCAACGAAAATGG + Intronic
1041399147 8:57422946-57422968 AGCTGGTTCTGCAAGCAAACTGG + Intergenic
1044025808 8:87170678-87170700 AGCTGGGTATACAAGGAAACTGG - Intronic
1044324455 8:90844022-90844044 AGGTGGGTAGAAAAGGAAAATGG + Intronic
1047061704 8:121234534-121234556 AGGTGGGGATACATAGAAACAGG - Intergenic
1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG + Intergenic
1050106372 9:2170451-2170473 AGTTGGAAATAGAAGGAAACAGG + Exonic
1053475438 9:38378893-38378915 AGCTGGGAATACCAGGAGGCAGG + Intergenic
1056958169 9:91099250-91099272 AGCTTGGTAGAGGAGGAAACAGG - Intergenic
1057815595 9:98291708-98291730 AGCAGGGTTTCCAGGGAAACTGG - Intronic
1057858488 9:98621250-98621272 AGCTGGTTACAGAAGGAACCAGG + Intronic
1058381385 9:104380759-104380781 AGATGGGAGTACAAGAAAACAGG - Intergenic
1058572759 9:106365449-106365471 AGGTGGGTTTACAAGGCTACAGG + Intergenic
1059858734 9:118432817-118432839 AGCTGGGTATAGAACTGAACTGG + Intergenic
1060551536 9:124487761-124487783 AGCTGGGGCTCCAGGGAAACTGG - Intronic
1061605484 9:131706986-131707008 AGCTGGGTATACAGACAGACAGG - Intronic
1061940558 9:133881554-133881576 AGCTGGGAACACAAGGAAGGGGG + Intronic
1187131602 X:16508640-16508662 TGGTAGGAATACAAGGAAACAGG - Intergenic
1187235695 X:17464969-17464991 AGCTGGCAATACATGGACACTGG + Intronic
1188063676 X:25631193-25631215 AGCTGAGTAAAGAAGAAAACTGG - Intergenic
1189206523 X:39244153-39244175 TGCTGGGGATACAAGGATAAAGG + Intergenic
1192443253 X:71190794-71190816 AGCTAGATATTGAAGGAAACTGG - Intergenic
1192631936 X:72784121-72784143 GGCTGCGTCTACAAGGAAACAGG - Intronic
1192649773 X:72936680-72936702 GGCTGCGTCTACAAGGAAACAGG + Intronic
1194034915 X:88858561-88858583 AGCTAGGTATACAGCTAAACAGG - Intergenic
1195535108 X:106001531-106001553 AGCTGGGTATAGAGGGACAATGG - Intergenic
1195880716 X:109590085-109590107 AGCAGGGCAAAGAAGGAAACAGG + Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196774559 X:119326621-119326643 AGGTGGGTATACATGAAAAAGGG - Intergenic
1196895692 X:120333538-120333560 AGCTGGGTATAGAAGATTACAGG - Intergenic
1201476131 Y:14383201-14383223 AGGTAGGTATACAAGTAGACAGG - Intergenic
1201476141 Y:14383434-14383456 AGGTAGGTATACAAGTAGACAGG - Intergenic
1201531086 Y:14990365-14990387 TGTTGGGTATCCAAGGAAAAAGG - Intergenic