ID: 1044030776

View in Genome Browser
Species Human (GRCh38)
Location 8:87233758-87233780
Sequence TGCCACAGCCAAACTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044030776_1044030779 -6 Left 1044030776 8:87233758-87233780 CCATGCCCAGTTTGGCTGTGGCA 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1044030779 8:87233775-87233797 GTGGCAATTTCTTAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044030776 Original CRISPR TGCCACAGCCAAACTGGGCA TGG (reversed) Intronic
900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG + Intergenic
901401786 1:9019631-9019653 AGACACAGCCAGGCTGGGCATGG + Intronic
902073399 1:13762360-13762382 TGCCACCACCACACTGGGGAAGG + Intronic
903375404 1:22862771-22862793 TGACACAGCCAAGCTGGGATAGG + Intronic
910609920 1:89129661-89129683 TGCCATGGCAAAACTGGGAAGGG + Intronic
913675926 1:121140050-121140072 TGGCACACCCAAGCAGGGCATGG + Intergenic
914027822 1:143927990-143928012 TGGCACACCCAAGCAGGGCATGG + Intergenic
916284704 1:163093663-163093685 TGCCCCAGCCAAACTCCACATGG - Intergenic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
920463296 1:206158887-206158909 TGGCACACCCAAGCAGGGCATGG + Intergenic
921168502 1:212525161-212525183 AGCCACAGTCAGACTGGCCAAGG - Intergenic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
921671575 1:217930100-217930122 TGTCACAGCCCAACTAGGCCAGG + Intergenic
922137041 1:222839348-222839370 TTCCACAGACAACGTGGGCAGGG - Intergenic
924217856 1:241843076-241843098 TTCCACAGCCAAACTACACAGGG + Intergenic
1063474267 10:6314924-6314946 TGCCACAGCTCAAAGGGGCATGG + Intergenic
1065022475 10:21511054-21511076 TCCCAGAGCCAAACTAGGAAAGG - Intergenic
1066495719 10:35939940-35939962 TGACACAGACGAACTGGGGATGG + Intergenic
1067121209 10:43473732-43473754 TACAACAGCCAGGCTGGGCAAGG + Intronic
1069684649 10:70309830-70309852 TGCCACAGGCTTGCTGGGCATGG + Intronic
1069807452 10:71134787-71134809 GGCCACTGCCAAATTGAGCAGGG + Intergenic
1071329574 10:84546406-84546428 AGTGACAGCCAGACTGGGCAGGG + Intergenic
1074077424 10:110141867-110141889 TGCCAAAGCCAAGCTGAGCATGG + Intergenic
1074086254 10:110210474-110210496 CTCTGCAGCCAAACTGGGCACGG - Intronic
1075090451 10:119441379-119441401 TCCCACAGCCCACCTGGGCAGGG - Intronic
1075275008 10:121085506-121085528 GGCCACAGCCACAATGGGCGGGG - Intergenic
1077642621 11:3895186-3895208 GGTCACAGGCAAACAGGGCAGGG + Intronic
1083315448 11:61812193-61812215 TGCCACAGCCCACCTGTGCCAGG - Intronic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1086967937 11:93049467-93049489 TGCCACGGTCATTCTGGGCATGG - Intergenic
1087086181 11:94220952-94220974 TGCTGCAGCCAAAATGTGCAGGG - Intergenic
1088926409 11:114307657-114307679 TGGCAGAGCCAGACTAGGCAGGG - Intronic
1089474303 11:118745956-118745978 TGCCAAACCCAAACAGGTCACGG + Intergenic
1091323334 11:134666787-134666809 AGCCACAGCCACACTTTGCAGGG + Intergenic
1091700296 12:2654499-2654521 TCCCAAGGCCAAACTTGGCAGGG + Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1096872327 12:54601135-54601157 TGACAGAGCCAAACAGGGTAGGG + Intergenic
1097683931 12:62674829-62674851 TACCACAGCCAAACCAAGCAAGG - Intronic
1098541755 12:71664573-71664595 TTCCACAGGTAACCTGGGCAGGG + Exonic
1103906473 12:124330184-124330206 TGCCTCAGCCCCACTGGGCCAGG + Intronic
1104946202 12:132415862-132415884 GGCCACAGCCAGGCTGGGGAGGG + Intergenic
1105361828 13:19725801-19725823 TGCCACACCCAAATTCTGCAGGG + Intronic
1105724450 13:23147844-23147866 TGCCCCAGCCAAACTCCGCATGG + Intergenic
1107925018 13:45250621-45250643 TGCCACAGCCAGACTCTGGAAGG - Intronic
1109944544 13:69416088-69416110 TGCCAAGGCCAAACTGGCTATGG + Intergenic
1112004851 13:95245395-95245417 TTGCACAGCCAAACTGGGCCAGG + Intronic
1113364318 13:109661952-109661974 TGGCACAGCATTACTGGGCAGGG + Intergenic
1113778106 13:112960461-112960483 TGCAACAACCAAAATGAGCAGGG - Intronic
1115224822 14:31091446-31091468 TCCCACGGCCAAACTGGGACTGG - Intronic
1118294844 14:64559375-64559397 TGCCACTGCTACACTGGGCTGGG + Intronic
1118455153 14:65938813-65938835 TGCAACACCAAAACTGGGTAAGG + Intergenic
1119195090 14:72711907-72711929 CACCACCCCCAAACTGGGCAAGG - Intronic
1121040331 14:90741071-90741093 TCCCACAGCTAAAGGGGGCAAGG + Intronic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1124050537 15:26193305-26193327 TGCCACAGATGACCTGGGCAAGG + Intergenic
1125222056 15:37349821-37349843 TGACACAGCAGAAGTGGGCAAGG - Intergenic
1128475383 15:67992910-67992932 TGCCACTGACTCACTGGGCAAGG - Intergenic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1130087828 15:80793196-80793218 TTACACAGCCAAGCTAGGCAAGG - Intronic
1130836507 15:87654958-87654980 TGCCACAGAGGGACTGGGCATGG + Intergenic
1130925996 15:88386358-88386380 TGCCGGAGCCAAGCTGGACATGG - Intergenic
1132467191 16:82783-82805 GGCCACAGCCAGGCTGGGCTGGG - Intronic
1133179054 16:4038791-4038813 TTCCACAGCGAGACTTGGCAGGG - Intronic
1133364065 16:5197099-5197121 TGCCACAGTCCATCTGTGCAAGG - Intergenic
1134634454 16:15781635-15781657 TGCCTGAGCCCAACAGGGCAGGG - Intronic
1135172043 16:20193393-20193415 GGCCACAGCCAACCTTGCCAAGG + Intergenic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1136925449 16:34368574-34368596 TGCCAAAGCCACACTGTGGAGGG + Intergenic
1136979125 16:35043232-35043254 TGCCAAAGCCACACTGTGGAGGG - Intergenic
1137540654 16:49359475-49359497 TGCCACAGCCAATCAGTGGAGGG - Intergenic
1139405913 16:66717532-66717554 TGCCACAACCAAAAAGGGTAGGG + Intergenic
1140761953 16:78117607-78117629 AGCCACAGCCTACTTGGGCAAGG - Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141732620 16:85833162-85833184 TGTCATACCCAAACAGGGCAAGG - Intergenic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142010694 16:87712338-87712360 AGCCACGCCCACACTGGGCATGG - Intronic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142283448 16:89161057-89161079 CGCCACAGCCCACCTGGGCCTGG - Intergenic
1142470649 17:161574-161596 TGCCTCAGACGCACTGGGCATGG + Intronic
1142995758 17:3759348-3759370 TGCCACAGAGACTCTGGGCATGG + Intronic
1143783769 17:9242438-9242460 TGCCACAGCCCTTCTGGGCAGGG - Exonic
1144203061 17:12958654-12958676 TGCCACACCCTTCCTGGGCAGGG - Intronic
1146464658 17:33076753-33076775 TGCAACAGTTAAACTGGGTAAGG - Intronic
1146831763 17:36075762-36075784 TGCCTGAGCCAAAATGAGCAGGG + Intergenic
1150216723 17:63475547-63475569 TCTCCAAGCCAAACTGGGCAGGG + Intergenic
1151540904 17:74764087-74764109 GGCCCGAGCCAAACAGGGCAGGG + Intronic
1152765324 17:82134182-82134204 TGCAACAGCCACCCTGGGAATGG + Intronic
1152865876 17:82722667-82722689 TGCCAGAGACAAACAGGGCCTGG - Intronic
1152995455 18:402297-402319 TCCCACAACCAGACTGGTCATGG - Intronic
1153110524 18:1580858-1580880 TGCCAAAGACACACTGGGGATGG + Intergenic
1154348686 18:13565370-13565392 TGCCAGCGCCAAGCTGGGCCAGG + Intronic
1156487826 18:37477795-37477817 TCCCACAACCAAACTTCGCAGGG + Intronic
1156604387 18:38648880-38648902 CTCCAAAGCCAAATTGGGCAGGG + Intergenic
1157483795 18:48073071-48073093 TTCCATGGCCAAACTGGGCCTGG - Intronic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1158544114 18:58381358-58381380 GGCCACAGACAAAGTGGGGAGGG - Intronic
1161903742 19:7139188-7139210 AGCCCCAGCCAAACTGGCCCAGG + Intronic
1167236034 19:48316081-48316103 GGCAACTGCCAAACTGGGCCAGG + Intronic
1168300965 19:55404891-55404913 TTCTACAGCCTGACTGGGCATGG - Intronic
925166443 2:1718812-1718834 TGCCACAGCCAAACAGGCTGAGG + Intronic
926336946 2:11870812-11870834 TGCCACAGCCGAGCTGGAGAGGG - Intergenic
927839775 2:26432692-26432714 TGACACAGCCAAAGTGGCCTAGG - Intronic
927929658 2:27036031-27036053 TGCCACGGCAAACCTAGGCAAGG + Exonic
929992855 2:46804124-46804146 TGCCACAGCCCCACGAGGCAGGG - Intergenic
932172695 2:69572022-69572044 AGCCACAGACAAACCTGGCAAGG + Intronic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
933607924 2:84403581-84403603 TGTCACAGCCACACTGGGGGTGG + Intergenic
934720660 2:96573583-96573605 TGCCAAAGCCAAACATGGCAGGG + Intergenic
935804020 2:106728940-106728962 TGACACAGCACAACTGGGAAAGG + Intergenic
935848063 2:107187929-107187951 TGCAAGAGCAAAACTAGGCATGG + Intergenic
936112887 2:109679238-109679260 TGCCACGGTCAAACAAGGCAAGG - Intergenic
939653465 2:144792602-144792624 TTTCTCTGCCAAACTGGGCATGG - Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
940456916 2:153913172-153913194 TGCCAAAGTGAAACTAGGCAGGG - Intronic
942839274 2:180340138-180340160 AGCCACAGCCAAGGTGAGCATGG + Intergenic
945931199 2:215856184-215856206 TGCCAAAGCTCAACTGTGCAGGG + Intergenic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
948259102 2:236589964-236589986 TGCAAAACCCAATCTGGGCACGG + Intergenic
948556856 2:238817992-238818014 TGCCACAGCCCCACTGGGCCTGG - Intergenic
948999309 2:241603219-241603241 AGACACAGCCAAAATGAGCAAGG - Intronic
948999331 2:241603319-241603341 AGACACAGCCAAAATGAGCAAGG - Intronic
948999351 2:241603419-241603441 AGACACAGCCAAAATGAGCAAGG - Intronic
948999372 2:241603519-241603541 AGACACAGCCAAAATGAGCAAGG - Intronic
949053670 2:241912142-241912164 TAACACAGACAAACAGGGCAGGG + Intergenic
1171422920 20:25030850-25030872 TGCCACAGCCAATGGGGACACGG + Exonic
1173638374 20:44581024-44581046 TGCCGCAGCCAGCCTGGGAAAGG - Intronic
1173901427 20:46592568-46592590 TCCCACTCCCAAAATGGGCATGG - Intronic
1174124595 20:48294339-48294361 TGACTCAGCCAAGCTTGGCATGG + Intergenic
1178595221 21:33947395-33947417 TGCCACAGGGAAACTGTGCTGGG - Intergenic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1180839627 22:18953218-18953240 TGCCCCAGCCAAACTCCGCGTGG + Intergenic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1182720216 22:32392245-32392267 TGCCTCACCCAAACTGGTTATGG - Exonic
1182740938 22:32567085-32567107 TGCCACAGTGAGACTGGGAAAGG + Intronic
1184717798 22:46291662-46291684 TGCCACAGACAGGCCGGGCACGG + Intronic
1184728698 22:46361107-46361129 TTCCACGGCCACCCTGGGCATGG + Exonic
952087883 3:29848574-29848596 TGCTTCAGCCAAAAAGGGCAGGG + Intronic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
953945698 3:47145543-47145565 AAACACAGCCAAGCTGGGCATGG - Intronic
954450747 3:50570128-50570150 TGTCCCAGGCAAGCTGGGCACGG - Intronic
957935666 3:86938585-86938607 AGTCACAGCCAAACTTGGTATGG + Exonic
964074106 3:152672205-152672227 TTGCACTGCCAAACTGGGAAGGG + Intergenic
967319810 3:188184293-188184315 AGCCAGAGCCAAACAGTGCAGGG - Intronic
968293820 3:197558155-197558177 TGTCACAGCAAAGCTGGGCTGGG - Intronic
969335003 4:6502596-6502618 TGCCACACCCAACCTGTGCTAGG + Intronic
980127440 4:128787500-128787522 CCCCACATCCAAGCTGGGCAGGG - Intergenic
980583945 4:134788985-134789007 TGCCAGAGTGAAACTAGGCATGG - Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
982127534 4:152197424-152197446 TGCCAAAGCCCAATTTGGCAGGG + Intergenic
985161372 4:187048044-187048066 TGCCACAGGCACACTGGTCCTGG + Intergenic
986985198 5:13493462-13493484 TGCCACAGTCAAACTCTGAAGGG - Intergenic
992752397 5:79873430-79873452 TGCCTCAGCCAAGTTGGCCAAGG - Intergenic
993877385 5:93323713-93323735 TGCTACAGCAAAACTGAACATGG + Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
994025332 5:95074944-95074966 CGACAGAGCCAAGCTGGGCATGG - Intronic
995259621 5:110087085-110087107 TCAGACAGCCAAAGTGGGCAGGG + Intergenic
998503692 5:142654954-142654976 TCCCACATCCAAACAGGGCCGGG + Intronic
1001426212 5:171624185-171624207 TGCCACAGCCACCCTGGGGTGGG + Intergenic
1002045060 5:176536982-176537004 TAGGACGGCCAAACTGGGCAGGG + Exonic
1002643389 5:180641119-180641141 GGACACAGCCCAACCGGGCAGGG - Intronic
1004007261 6:11648700-11648722 TTCCACAGCCTAGCTGGGAAAGG + Intergenic
1005975443 6:30794664-30794686 TGGCACTGCCCAGCTGGGCATGG - Intergenic
1006059510 6:31410140-31410162 CACCACAGCCACACTGGACATGG + Intronic
1006072001 6:31505208-31505230 CACCACAGCCACACTGGACATGG + Intronic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1013304698 6:108837628-108837650 TGCCACAGGCAAAGTTGTCAGGG - Intergenic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1017456223 6:154603879-154603901 TGCCACAGCCCAACTTGGCCAGG + Intergenic
1019216299 6:170446135-170446157 TGCCTCAGCCCAACAGAGCATGG + Intergenic
1021962464 7:25886543-25886565 TGCCACAGGCAAACTGTGACAGG - Intergenic
1022656041 7:32320017-32320039 CGACACAGCCAAATTGGGGAGGG + Intergenic
1023031702 7:36095390-36095412 TGCCACCGCCACCCTGGCCATGG + Intergenic
1023364043 7:39445413-39445435 TGCATCAGCCGAACTTGGCAGGG - Intronic
1027651425 7:80873269-80873291 AGGCACAGCCAGACTGTGCAGGG + Intronic
1032171991 7:129592584-129592606 TACCACAGCCTAACTGGGCTGGG - Intergenic
1032388360 7:131539759-131539781 TGCAGCACCCAGACTGGGCACGG - Intronic
1032442584 7:131953445-131953467 GGCCAGAGGCAAACTGGACAGGG - Intergenic
1033864697 7:145674247-145674269 TGCCAAAGGAAAAATGGGCAAGG - Intergenic
1035670958 8:1416954-1416976 TGCCACAGCCGCACTGAGCTGGG - Intergenic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1037567031 8:20126656-20126678 AGCCACAGCTAATATGGGCAGGG + Intergenic
1041223276 8:55673109-55673131 AGAGACAGCCAAACTGGGCTTGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045826391 8:106403333-106403355 TGTCACAGGCAAGGTGGGCAGGG - Intronic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1050112872 9:2234785-2234807 TGCCAATGCTAAACTGGGCTGGG + Intergenic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1052802305 9:32980393-32980415 TGCCAGAGCCACATTGGACAAGG - Intronic
1053020096 9:34688684-34688706 TCTCTCAGCCAAACTGAGCAAGG - Intergenic
1053285803 9:36848867-36848889 AGCCAAAGCCAATCTGGGGATGG - Intronic
1055939676 9:81637505-81637527 TTCAACAGCCTAACTGGCCATGG + Intronic
1056457570 9:86775868-86775890 TGCCACATCAAATGTGGGCAAGG - Intergenic
1056566721 9:87779309-87779331 TCCCCCAGCCAAGCTGGTCACGG - Intergenic
1056568500 9:87796003-87796025 TTCCACAGCCAGGCTTGGCATGG + Intergenic
1057205077 9:93166941-93166963 TCCCACAGCCGGGCTGGGCAAGG + Intergenic
1058935536 9:109766368-109766390 GCCCACAGCTAGACTGGGCAAGG + Intronic
1060104733 9:120866529-120866551 TCCCACAGCAACCCTGGGCAGGG + Intronic
1060531402 9:124349016-124349038 TGCCCCGGCCAAACTGCACAGGG + Intronic
1062514642 9:136926457-136926479 TCCCACAGCCAGCCTGGCCAAGG - Exonic
1062549858 9:137080957-137080979 TGCGACAGCCATGCTGGGGAGGG + Intronic
1186421623 X:9431524-9431546 TGACACATGCAAACAGGGCATGG + Intergenic
1187908262 X:24087259-24087281 TGGCACAGCCTGGCTGGGCATGG - Intergenic
1190708485 X:53049137-53049159 TGCCACTGCCAAGCTGGGAGGGG - Exonic
1195927256 X:110038412-110038434 TCCCTGAGCCAAAGTGGGCATGG - Intronic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1197862813 X:130988329-130988351 TGCCACCGCCCAACTTGGCCTGG + Intergenic