ID: 1044031757

View in Genome Browser
Species Human (GRCh38)
Location 8:87247045-87247067
Sequence AAACTCTGCTTCACAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044031752_1044031757 27 Left 1044031752 8:87246995-87247017 CCTATGTCCAGTCTACTCCATAA 0: 1
1: 1
2: 0
3: 7
4: 89
Right 1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG No data
1044031753_1044031757 20 Left 1044031753 8:87247002-87247024 CCAGTCTACTCCATAATCTCGTT 0: 4
1: 12
2: 22
3: 30
4: 105
Right 1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG No data
1044031755_1044031757 10 Left 1044031755 8:87247012-87247034 CCATAATCTCGTTTTGGTTACTG 0: 1
1: 5
2: 22
3: 16
4: 106
Right 1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044031757 Original CRISPR AAACTCTGCTTCACAAAGGT AGG Intronic
No off target data available for this crispr