ID: 1044032827

View in Genome Browser
Species Human (GRCh38)
Location 8:87259772-87259794
Sequence CTGGACTCCTTAGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 10, 2: 19, 3: 30, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044032827_1044032831 29 Left 1044032827 8:87259772-87259794 CCTGTTTTTCCTAAGGAGTCCAG 0: 1
1: 10
2: 19
3: 30
4: 153
Right 1044032831 8:87259824-87259846 TTAAGCTGAGTTTTAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044032827 Original CRISPR CTGGACTCCTTAGGAAAAAC AGG (reversed) Intronic
900487369 1:2929646-2929668 CTGGAGTCCTTATTAAAAAGGGG - Intergenic
903833047 1:26186121-26186143 CTGGACTCCTCAGGATGGACTGG - Intronic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
905856010 1:41314635-41314657 CTGGAATCCTGAGGAAGAAATGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
910401372 1:86841236-86841258 ATGGGCTCTTTAGGAAAGACAGG + Intergenic
912180433 1:107212752-107212774 CTGGTATCTATAGGAAAAACTGG - Intronic
915067679 1:153240094-153240116 CTGGCATCCTGAGGAAAAGCTGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
919299184 1:195739080-195739102 CTTGCCTCCTTAGAAAAAAAGGG - Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921930488 1:220750263-220750285 CTGGACACCTTCCAAAAAACTGG + Intronic
923886899 1:238167721-238167743 CTGGACTTCTTAGTTAAATCAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063016600 10:2084151-2084173 CTGGTGTCCTTATAAAAAACAGG + Intergenic
1065907233 10:30267221-30267243 CTAGACTCTTTAAGAAAAAAAGG + Intergenic
1068375685 10:56177024-56177046 CTGGACTCAGTAAGACAAACTGG + Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1070193681 10:74136328-74136350 CTGGCTTCTTTAGGAATAACTGG + Intronic
1070957563 10:80474336-80474358 CTTGGGTCCTTAGGAAAAAGAGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072424167 10:95315337-95315359 CTGGGTTCCTTCTGAAAAACAGG - Intronic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1074688784 10:115984030-115984052 CTGGACTATTTAGGTAAAAGAGG + Intergenic
1076133301 10:128028467-128028489 CTGCATTTCTTAGGAAAAATGGG + Intronic
1076711995 10:132341772-132341794 CTGCACATCTTAGGAAAGACTGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078876994 11:15409028-15409050 CGGGGCTTCTCAGGAAAAACTGG + Intergenic
1080185965 11:29486734-29486756 CTGGAATTCTTAGAAAAAAATGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1089168209 11:116493980-116494002 CTGGGCTCCTGAGGAAACATGGG - Intergenic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1090259373 11:125307678-125307700 CTTTACTCTTTAGGAAAAAGAGG + Intronic
1093448594 12:19289251-19289273 TTGGATTCCTTAGATAAAACTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1095602669 12:44031833-44031855 CAGGACACAATAGGAAAAACTGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098587199 12:72167941-72167963 CTGGCTTTCTTAGGAAAAAGAGG + Intronic
1101185036 12:102267172-102267194 CTCAAGTCCTGAGGAAAAACAGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101317820 12:103645395-103645417 CTGCAATCCTTAGGAAAGAAAGG + Intronic
1103792939 12:123484399-123484421 CTGGACTCTTCAGAATAAACTGG - Intronic
1104213344 12:126711624-126711646 CTGACCTCATGAGGAAAAACAGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107852670 13:44586844-44586866 CTGTTCTCCTTAGAAAAAAAAGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1111469664 13:88662061-88662083 TTTGACTCTATAGGAAAAACAGG - Intergenic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1114246328 14:20917956-20917978 CTGGAGTCCTTAGGTAAATGTGG - Intergenic
1115721265 14:36163358-36163380 CTGGATTCCATAGGAAATAAAGG - Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118545383 14:66881362-66881384 CTTAATTCCATAGGAAAAACGGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119911861 14:78356817-78356839 CTGGACTACTCAGCAAAAAAGGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121818066 14:96943502-96943524 CTGGTCTCCTAAGGAGAAAGGGG - Intergenic
1125022053 15:34995738-34995760 CTGGTGTCCTTATGAAAAGCAGG + Intergenic
1133592022 16:7254343-7254365 CTGGGCTCCTTAGGTTAATCGGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138789120 16:59881499-59881521 CTGGATTCATTAGGAAGCACAGG + Intergenic
1143615850 17:8048638-8048660 AAGGACTCCTCAGAAAAAACAGG + Exonic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146812661 17:35916329-35916351 CTGGCCTCCATAGGAGGAACTGG + Intergenic
1150089377 17:62308877-62308899 CTTCACTCCTTAGAAAAAAGAGG - Intergenic
1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155054845 18:22173506-22173528 CAGGATTCCTTAGGATAAAATGG + Intronic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1157305480 18:46514015-46514037 CTGGGCTCCTTAGGGACCACTGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1158021548 18:52848032-52848054 CTGTACTTCAGAGGAAAAACAGG + Intronic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167298172 19:48663962-48663984 CTGGACTCTTGAGGAAAAGGAGG - Intronic
1167800671 19:51739333-51739355 CTGGTGTCCTTATGAAAAAAGGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168487472 19:56776517-56776539 CAGGACTACTGAGGAAACACTGG + Intronic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
932534293 2:72576007-72576029 CTGGCCTACTAAGGCAAAACTGG - Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933178833 2:79207310-79207332 CTGGACTACCTAGGTGAAACCGG - Intronic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
935319414 2:101871478-101871500 CTGTACTCTGTAGAAAAAACAGG - Intronic
936913746 2:117618245-117618267 CTAGACTCCTGAGGAAAGAAGGG - Intergenic
940131394 2:150387185-150387207 CTGGGCTCAGTAGGAAAAGCTGG - Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942208731 2:173649594-173649616 CTGCACCACTTAGGAAAATCAGG - Intergenic
942290428 2:174464203-174464225 CTCTACACCTTAGGAAACACTGG - Intronic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
945799942 2:214415765-214415787 CTAGATTCCTTAGGACAAAAGGG + Intronic
946207642 2:218121398-218121420 CTCGAATTCTAAGGAAAAACAGG + Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1170444848 20:16415860-16415882 CTACATTCCTTAGGAGAAACAGG - Intronic
1172178123 20:32984863-32984885 CTGGGCTCATCAGGAAAAAGGGG + Intronic
1175263575 20:57689478-57689500 CTGGACTCCCCAGGAGGAACGGG - Intronic
1178534673 21:33402505-33402527 CTGGACACGTTAGCAAAAATGGG - Intergenic
1178961045 21:37065252-37065274 CTGGGCCCCTCAGGACAAACAGG + Exonic
1180637093 22:17269920-17269942 CTGACCTGCTTAGGAAACACAGG + Intergenic
1181049502 22:20231877-20231899 CTGGACACCTGTGGAAAGACAGG - Intergenic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG + Intronic
957244402 3:77699800-77699822 CTGGATTCCTTTAGAAGAACTGG + Intergenic
960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG + Intergenic
960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG + Intergenic
961097185 3:124167398-124167420 CTGGACTCCCTAGAGAACACAGG + Intronic
961191972 3:124969597-124969619 GTGGATTCCTGAGGAAGAACAGG - Exonic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961942746 3:130655145-130655167 CTGGACACCTCAGGAACAATGGG - Intronic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965044437 3:163557490-163557512 CTGGTGGCCTTAAGAAAAACGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966219590 3:177537496-177537518 CTGGACTTGTTAGAAAATACAGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968565470 4:1310361-1310383 CGGCACTGCTTAGGAAAGACGGG - Intronic
969269507 4:6089620-6089642 CTTGACTGCTTAGAAACAACCGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969890399 4:10254881-10254903 GTTGGCTCCTCAGGAAAAACTGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
977720387 4:100233007-100233029 TTGGCTTGCTTAGGAAAAACCGG - Intergenic
978481088 4:109191551-109191573 ATGCACTCCTTATGGAAAACAGG - Intronic
979299326 4:119068500-119068522 TAGGATTCCTTAGAAAAAACAGG - Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986173457 5:5332320-5332342 CTGGTCTCCCCAGGAAAACCAGG + Intergenic
988464491 5:31475393-31475415 CTGGGCTCCTTAGCAAAGAGAGG - Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991030064 5:62073402-62073424 CTAGACTCCTTATGCAAAAGGGG - Intergenic
993044445 5:82851638-82851660 TTGGAATGCTTAGAAAAAACTGG - Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
999925642 5:156373284-156373306 CTGGACTTTTCAAGAAAAACAGG + Intronic
1005064131 6:21801808-21801830 GTGGCCTCATTAGGAAATACGGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011543518 6:88459224-88459246 CTGTATTCCTTAGGGAAAAATGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015582758 6:134744567-134744589 CTGAACTCATTAAGAAAGACTGG + Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017441237 6:154466263-154466285 CTGGAGCCCTTAGGATATACAGG - Intronic
1017554538 6:155548711-155548733 CTGGCAGACTTAGGAAAAACAGG - Intergenic
1017681229 6:156866065-156866087 GTGGGCTCCTTAGGGAAATCTGG + Intronic
1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG + Intronic
1018818714 6:167356181-167356203 CTGTGCTCCTTAGGAAAACATGG + Intronic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1019829216 7:3309934-3309956 CTGAACTACTTAAGAAAAAAAGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021957344 7:25839262-25839284 GTGGACTCCTCAGGAATAGCAGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023762642 7:43480903-43480925 CAGGACTCCTTCTGAAAAAGTGG - Intronic
1024419416 7:49145037-49145059 TTTGAGTGCTTAGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1027491304 7:78830791-78830813 CTGGATTCCTAAGCAAAAAGGGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030701521 7:112646672-112646694 CTGGATTCCTTAGAATTAACAGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1035552806 8:543352-543374 CAGGATTCATTAGGAAAAATGGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040456850 8:47606702-47606724 CTAGACTCCTTTTGAAAAGCTGG + Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG + Intergenic
1050532494 9:6602785-6602807 CTGAACTTCTTAGGAGACACAGG + Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053311448 9:37023383-37023405 CTGGAGTCCATAGGAAGTACAGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059570874 9:115434060-115434082 CTTGAGTCCTTAGGGAAAAATGG - Intergenic
1188740850 X:33779372-33779394 CTTCACTCCTTAGGTAATACAGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198731326 X:139733129-139733151 GAGGACTCTGTAGGAAAAACAGG - Intronic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic