ID: 1044038754

View in Genome Browser
Species Human (GRCh38)
Location 8:87338857-87338879
Sequence CCTTACAACCACATTACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 17, 2: 53, 3: 107, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044038754_1044038760 -8 Left 1044038754 8:87338857-87338879 CCTTTAGTAATGTGGTTGTAAGG 0: 1
1: 17
2: 53
3: 107
4: 201
Right 1044038760 8:87338872-87338894 TTGTAAGGTGTGTGGGTGAGGGG No data
1044038754_1044038758 -10 Left 1044038754 8:87338857-87338879 CCTTTAGTAATGTGGTTGTAAGG 0: 1
1: 17
2: 53
3: 107
4: 201
Right 1044038758 8:87338870-87338892 GGTTGTAAGGTGTGTGGGTGAGG No data
1044038754_1044038759 -9 Left 1044038754 8:87338857-87338879 CCTTTAGTAATGTGGTTGTAAGG 0: 1
1: 17
2: 53
3: 107
4: 201
Right 1044038759 8:87338871-87338893 GTTGTAAGGTGTGTGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044038754 Original CRISPR CCTTACAACCACATTACTAA AGG (reversed) Intronic
901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG + Intergenic
902901853 1:19522804-19522826 ACTTACAACCACAATACTTTGGG + Intergenic
903309768 1:22445463-22445485 CCTTACCACCACATCACTAAAGG + Intergenic
903313961 1:22486182-22486204 CCCTACTACCACATCACTAAAGG - Intronic
904228608 1:29046957-29046979 CCTGACCACAACATTACAAAAGG - Intronic
905287853 1:36895156-36895178 CCTTACCACTAAATCACTAAAGG + Intronic
905964909 1:42084358-42084380 CCTTGCCACTACATTACTAAAGG - Intergenic
906017671 1:42596634-42596656 CTTCACCACCACATCACTAACGG + Intronic
906046288 1:42833480-42833502 CCTTAAAATCATATTACTTAGGG - Intronic
906453060 1:45969302-45969324 CCTTACCAATACATTACTAAAGG - Intronic
906885882 1:49647919-49647941 TCTTACCACCACATTACTAAAGG + Intronic
907090997 1:51725548-51725570 CCTTACCACCACATTACTAAAGG - Intronic
908809460 1:67965051-67965073 GCTTAACACCACATGACTAAAGG - Intergenic
909246111 1:73287141-73287163 CCTTACCATCACATTACTAGAGG - Intergenic
909496645 1:76286350-76286372 CCTTACAAACACATCATTACTGG - Intronic
910372877 1:86536851-86536873 CCTTACCACCACATTTTTACAGG - Intergenic
910768399 1:90806416-90806438 CCTTACTGCTACATCACTAAAGG - Intergenic
911276123 1:95861586-95861608 ACTAACCACCACATCACTAAAGG - Intergenic
911591223 1:99750271-99750293 CCTTACCACCACATTATTAAAGG + Intronic
911713220 1:101098698-101098720 CCTTATCACCATATTAGTAAAGG - Intergenic
911868475 1:103059384-103059406 CCTTACCAACACATAGCTAAGGG + Intronic
912855335 1:113164037-113164059 TCTGACTACCACATTACTAGAGG - Intergenic
912970364 1:114275666-114275688 CCTTGCCACCACAATACTAAAGG + Intergenic
914972041 1:152315033-152315055 CCAAACATCAACATTACTAAGGG - Intronic
916386801 1:164282119-164282141 TCTTACCATCACATTACCAATGG + Intergenic
916603781 1:166321264-166321286 CCTTACCACTATATTACCAAAGG - Intergenic
917782558 1:178413487-178413509 CCTTACTACTACATGACTAAAGG + Intronic
918352262 1:183669632-183669654 CCTTACCACTACATTACTAAAGG - Intronic
918485248 1:185022058-185022080 ACTTACCACTACATTCCTAAAGG + Intergenic
918775127 1:188618781-188618803 CTTTAAAACCAGATTAATAAAGG - Intergenic
919117368 1:193297094-193297116 CTTTACCACCACATCATTAACGG + Intergenic
921093674 1:211868258-211868280 CCTTACCATTACTTTACTAAAGG - Intergenic
921605306 1:217145072-217145094 CCTTGTCACCACATTACTAAAGG + Intergenic
921769406 1:219017596-219017618 GCTTACCATCACATTACTAAAGG + Intergenic
922655552 1:227379437-227379459 CCTTACGCCTACATGACTAAAGG + Intergenic
923023418 1:230185402-230185424 CCTTAACACCACACAACTAAAGG - Intronic
923657811 1:235933412-235933434 CCTTACAACCACTCTGCGAAGGG + Intergenic
1063778217 10:9288873-9288895 CCATACAACCAAATCACTGAAGG + Intergenic
1064701555 10:18027125-18027147 CCTTCTTACCACATTACTAATGG - Intronic
1064705288 10:18066693-18066715 CCTCACCACCACAATACTAACGG - Intergenic
1064796053 10:19012494-19012516 CCTTACAATTACATTGCAAAAGG - Intergenic
1069647261 10:70009694-70009716 CCTTACCACCACATCACTGAAGG + Intergenic
1071080796 10:81807459-81807481 CCCTACCACCACATTACTAAAGG + Intergenic
1071552588 10:86578501-86578523 CCTTACCACCACAGGACTAAAGG - Intergenic
1072005329 10:91240564-91240586 CCTTACCTCAACATTTCTAATGG - Exonic
1072120057 10:92398171-92398193 CCTCACCACCACATCACTCAAGG + Intergenic
1072825718 10:98604032-98604054 CCTTACCACCGTATTACTAAAGG + Intronic
1072846096 10:98832024-98832046 CCTTCCAACCACTTTATTGATGG - Intronic
1073654682 10:105400155-105400177 CTTCACCACCACATTACTCAAGG + Intergenic
1073835551 10:107437076-107437098 ACTTATTGCCACATTACTAAAGG - Intergenic
1073890966 10:108100062-108100084 CCTTGCTACTACATTGCTAAAGG + Intergenic
1074177447 10:111023247-111023269 CCTTAGCACTACATCACTAAAGG + Intergenic
1074244229 10:111671311-111671333 TTTTACCACCACATTAATAAAGG + Intergenic
1074926225 10:118075115-118075137 CCATACTATCACATTACTAAAGG - Intergenic
1075794771 10:125112040-125112062 CCTTACAACCAAGTTTCAAATGG + Intronic
1078591414 11:12643300-12643322 CCTTACCACCACATTACTGAAGG + Intergenic
1079515936 11:21268675-21268697 ACTTCCCACCACATTACAAAAGG + Intronic
1080166698 11:29245499-29245521 CCTTACCACCATGTGACTAAAGG + Intergenic
1080856734 11:36118180-36118202 CCTTTCAACCAGAGTACTATTGG - Intronic
1080936854 11:36872485-36872507 CCATAAAACAACATTGCTAATGG + Intergenic
1080947194 11:36986632-36986654 CATTACTATCACATCACTAAAGG + Intergenic
1081340366 11:41920344-41920366 ACTTACCATCACATTATTAAAGG - Intergenic
1082246620 11:49930731-49930753 CCTTATAAGCACATTAATCATGG + Intergenic
1082564004 11:54653850-54653872 CCTTATAAGCACATTAATCATGG - Intergenic
1083473917 11:62903469-62903491 ACTTAGAACCACTTTGCTAATGG - Intergenic
1085431631 11:76455586-76455608 CCTTTCAACCACATTCCTTCAGG - Intronic
1087393339 11:97567308-97567330 CCTTAACACTCCATTACTAAAGG + Intergenic
1088929344 11:114333981-114334003 CCTCACCAACACATTACTAAAGG + Intergenic
1090682213 11:129073133-129073155 CCTTACCATCACATTACTAACGG + Intronic
1090768662 11:129898940-129898962 CCTTACCACCACATTGCTAAAGG - Intergenic
1090842031 11:130498734-130498756 CCTTACCACCACATTAATAAAGG - Intergenic
1092806307 12:12226215-12226237 GCTTACCATCACATTACAAAAGG + Intronic
1093586205 12:20840269-20840291 CCTTACCAACACATTATTGAAGG - Intronic
1093697755 12:22181318-22181340 CCTTACAACCACACGAATAAAGG + Intronic
1094738079 12:33258399-33258421 CCTTACAACCAAAATGCTTATGG - Intergenic
1095609004 12:44105563-44105585 CCTTACTACCACATTAGTAAAGG - Intronic
1097456371 12:59803635-59803657 CCTTACCACCACATTACTAAAGG - Intergenic
1097718404 12:62993501-62993523 CCTTACCAACACATTACTAAAGG - Intergenic
1099104635 12:78483316-78483338 CCCTATATCCACTTTACTAAAGG + Intergenic
1099525505 12:83713616-83713638 CCTTACCACCATTTTACTATAGG + Intergenic
1099907130 12:88784742-88784764 CCTTACCACCACATTAATAAAGG + Intergenic
1101649777 12:106667008-106667030 CCTTACCACCATATGACTAAAGG - Intronic
1102180299 12:110907544-110907566 CCTGTCACACACATTACTAAGGG + Intergenic
1102539996 12:113611632-113611654 CCTTACAACCAAATTACAAAAGG + Intergenic
1105056246 12:133102038-133102060 CCTTACCACTACATTACAAAAGG - Intronic
1105770064 13:23600816-23600838 TCTCACCTCCACATTACTAAAGG + Intronic
1106051506 13:26194485-26194507 CCTTATCATCACATCACTAAAGG + Intronic
1106306393 13:28515035-28515057 CCTTACCTCCACATCACTAAAGG - Intergenic
1107819780 13:44276141-44276163 CCTCGCCACCACATTATTAAAGG - Intergenic
1107918347 13:45176531-45176553 TTTTAAAACCACATAACTAAGGG - Intronic
1108521077 13:51247420-51247442 CCTTACAACCACCATAGAAAGGG - Intronic
1109697170 13:65976345-65976367 GCTTACCTCCATATTACTAATGG - Intergenic
1110214583 13:73011718-73011740 CCTTACCACCACATTACCAAAGG + Intronic
1110875373 13:80503142-80503164 CCTTACAACAATCTTACAAATGG - Intergenic
1110989359 13:82018500-82018522 CATTACCATCACATTACTAAAGG + Intergenic
1114998642 14:28392980-28393002 TATTACCACTACATTACTAAAGG - Intergenic
1115668625 14:35582982-35583004 CCTTACCACCATACCACTAAAGG + Intronic
1116811048 14:49540602-49540624 CCTTACCACCACATCACTTAAGG + Intergenic
1117608024 14:57452024-57452046 ACTTACCACTACATTACTAAAGG - Intergenic
1117652055 14:57917597-57917619 CATTACCACTATATTACTAAAGG - Intronic
1118889732 14:69898914-69898936 TCTTACCACCACATCACTAAAGG - Intronic
1120007127 14:79371226-79371248 CCTTACAAACACATGACTAAAGG - Intronic
1120078657 14:80189203-80189225 CCTTACCATCACATTACTAAAGG + Intergenic
1120344461 14:83267700-83267722 GCTTGCAAGCACATTAATAAGGG + Intergenic
1120364690 14:83551014-83551036 CCTTATAACAACATGACTGATGG - Intergenic
1121220740 14:92283607-92283629 CCTTACCCACACATGACTAATGG + Intergenic
1122764617 14:104057871-104057893 CCTTAAATACACATTGCTAAGGG - Intergenic
1123913842 15:25000358-25000380 CCTTACAATCATATTGCTGAGGG - Intergenic
1126249085 15:46545499-46545521 CCTTACCAACACATTGCTAAAGG - Intergenic
1126344609 15:47679753-47679775 CGTTACAGCCACATTACTGATGG - Intronic
1126655920 15:50977403-50977425 CCATAGAACCACATTATAAATGG + Intronic
1126833724 15:52637032-52637054 CTATCCAACCACCTTACTAAGGG + Intronic
1127162863 15:56208439-56208461 CCTTACTACCACATTACTAAAGG + Intronic
1127710654 15:61594379-61594401 CCTTGCAACTAAATTAGTAAGGG - Intergenic
1128819751 15:70641138-70641160 TGTTACAACCACAGTACTATGGG - Intergenic
1128901914 15:71430816-71430838 CCTTACATACACATTTCTTATGG - Intronic
1129997658 15:80020793-80020815 CCTTGCCACCACATCACTAAAGG - Intergenic
1130309724 15:82742683-82742705 CCTTACCCCCACATTACTAAAGG + Intergenic
1130328977 15:82904793-82904815 CCTTATCACCACATTACTAAAGG + Intronic
1132022777 15:98377342-98377364 CCTTACCACCACACAGCTAAAGG + Intergenic
1137475268 16:48802429-48802451 CCTTACCCCCACACTACTACAGG + Intergenic
1138625431 16:58248021-58248043 CATTACAACCACTTCACGAAAGG - Intronic
1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG + Exonic
1139122013 16:64032068-64032090 CCTTACCACTACATAACTAAAGG - Intergenic
1143717211 17:8782684-8782706 CCTTACCACCACATTACTAAAGG + Intergenic
1144451486 17:15383520-15383542 CATTACAACCACTTTAAAAATGG + Intergenic
1144940841 17:18939152-18939174 CCTCACCACCACATCACTAAAGG + Intergenic
1145228628 17:21152928-21152950 CCTTACCACTACGTTACTAAAGG + Intronic
1146106220 17:30039664-30039686 CCATACCTCCACCTTACTAAAGG + Intronic
1146629435 17:34459302-34459324 CCTCCCAACCCCATTACAAAAGG - Intergenic
1148287569 17:46409027-46409049 CCTCACAATCACATGCCTAAAGG - Intergenic
1148309737 17:46626606-46626628 CCTCACAATCACATGCCTAAAGG - Exonic
1149111610 17:53038346-53038368 TCTTACAAACACATTACTTATGG + Intergenic
1149722103 17:58855464-58855486 TCTTACTACCACGTTACTAAAGG + Intronic
1149727431 17:58910605-58910627 CCTTATCACCACATTACTAAAGG - Intronic
1150178361 17:63087295-63087317 CCTGAACACTACATTACTAAAGG - Intronic
1150614234 17:66756457-66756479 CCTCACCACCACATCACTAAAGG + Intronic
1151922750 17:77169878-77169900 CCTTACATTCACTTTACCAAAGG - Intronic
1152983535 18:301676-301698 CCTTAAATGCACATTGCTAACGG - Intergenic
1153687848 18:7564970-7564992 CCTTCCATCCACATTTCAAAGGG - Intergenic
1153989840 18:10386411-10386433 CCTTACAAGCTCATTCCTCAGGG - Intergenic
1155307674 18:24494751-24494773 ACTCACAACCACATCACTAATGG - Intergenic
1156663338 18:39375371-39375393 CTTCACCACCACATTATTAAAGG - Intergenic
1157967969 18:52230319-52230341 CCTTATAACCACTTTCCTAGGGG + Intergenic
1158461462 18:57649607-57649629 CCTCACAGCCACATTTCTCATGG + Intronic
1160056166 18:75482914-75482936 CCTTACCACCACATTACTAAAGG + Intergenic
1162624969 19:11878078-11878100 AATTACAACCACAATCCTAAAGG + Intronic
1163198760 19:15746722-15746744 CCTTACTGCCATATTGCTAAAGG - Intergenic
1164533917 19:29069959-29069981 TCTTATCACCACATTACTAAAGG + Intergenic
1164815292 19:31194605-31194627 CCTTACTACCACTTTACTAAAGG + Intergenic
1168578393 19:57533174-57533196 CCTCACCACCACATTATTAAAGG - Intronic
925784483 2:7417809-7417831 CTTTACCACCACATTACTAAAGG - Intergenic
930716171 2:54596016-54596038 TCTTACAACCACGGTACAAAAGG - Intronic
930722839 2:54654275-54654297 CTTTCCATGCACATTACTAAAGG + Intronic
931496077 2:62808737-62808759 CCTTACCATCACATTACTCAAGG - Intronic
934128471 2:88921558-88921580 CCTTACCCCCATATTATTAAAGG + Intergenic
934637656 2:96005606-96005628 CCTTACTACGACATTACTATAGG - Intergenic
935440063 2:103082571-103082593 CCTTACCGCCACATTCCTGAAGG + Intergenic
938060432 2:128250498-128250520 ACTCACAGCCACATTACAAAAGG - Intronic
938913707 2:135912465-135912487 ACTTAAAACCAAATTACTTACGG + Exonic
940372178 2:152916000-152916022 CCTTATAATCATCTTACTAAAGG - Intergenic
941250662 2:163157397-163157419 CCTTACCAGTACATCACTAAAGG + Intergenic
941570893 2:167169089-167169111 CCTTACCACTATACTACTAAAGG - Intronic
943301755 2:186211548-186211570 TCTGACCACCACATTATTAAAGG - Intergenic
943582540 2:189701922-189701944 CCTTACCATCACATTATTAAAGG - Intronic
944109646 2:196118578-196118600 CCTGTAAAACACATTACTAAAGG - Intergenic
944433073 2:199657727-199657749 CCTTACTACCATATTATTAAAGG - Intergenic
1168737489 20:154540-154562 CTTTACAACCACATGACCAGTGG - Intergenic
1169735562 20:8833933-8833955 CTTTACAACCACATTTCTTGTGG + Intronic
1170355132 20:15484296-15484318 TCTAACCACCACATGACTAAAGG - Intronic
1170416586 20:16148983-16149005 TCTTACCACCACATTATTAAAGG + Intergenic
1170449482 20:16467307-16467329 CCTCACCACCACCTCACTAAAGG + Intronic
1170721333 20:18882247-18882269 CCTTACCACCACATCACTAAAGG - Intergenic
1171137614 20:22710998-22711020 CCTTACCACCACATCATTAAAGG - Intergenic
1174114627 20:48218427-48218449 CCTGACTACCTCATTTCTAATGG + Intergenic
1175437464 20:58963694-58963716 CCTTACCAACACATTACTAAAGG + Intergenic
1175454549 20:59102071-59102093 GCTTACCACCACAGTACTAAAGG - Intergenic
1175484250 20:59333660-59333682 CCATAAAATCACATTACAAAGGG + Intergenic
1177282879 21:19007179-19007201 CATTACCACAACATTACTGAAGG + Intergenic
1177384054 21:20385981-20386003 CCTTACCATCACACCACTAAAGG - Intergenic
1177468436 21:21521310-21521332 CATTACCTCCAAATTACTAAAGG + Intronic
1177621063 21:23593716-23593738 TCTTCCCACCACATTACTAAAGG + Intergenic
1180656211 22:17423121-17423143 CCTCACCACCACATTGCTAAAGG - Intronic
1182056892 22:27365497-27365519 GCTTACCACCACATTACTAAAGG - Intergenic
1182284795 22:29239692-29239714 CCTTCTCACTACATTACTAAAGG - Intronic
1183766225 22:39877833-39877855 ACTTACTGCCACATCACTAAAGG + Intronic
949744623 3:7275401-7275423 CCTTACCAACATATTAGTAAAGG - Intronic
949911476 3:8913009-8913031 CCTTACAAACACACTACAAATGG + Intronic
950737864 3:15025206-15025228 CCTTAAAAACAGATTACCAAGGG + Intronic
951257593 3:20468416-20468438 CCTCATCACCACATTACCAAAGG - Intergenic
951533218 3:23717724-23717746 CCTTACAACATCATTACAGAAGG - Intergenic
951619252 3:24583114-24583136 CCTCACAACCCCATCACTGAAGG + Intergenic
952472515 3:33671262-33671284 CCTTACCAACACATTACTAAAGG + Intronic
954585687 3:51734351-51734373 CATTACCACTCCATTACTAAAGG - Intergenic
955421733 3:58744999-58745021 GCTAACAACCACATTAATAATGG + Intronic
956953747 3:74312702-74312724 CCTTACCATTACATTACTAGAGG + Intronic
957277790 3:78110834-78110856 CCTTACCACTACATTACTGAAGG + Intergenic
957679161 3:83409115-83409137 CCTTACAACCAGGTTTTTAAAGG - Intergenic
958058284 3:88442386-88442408 CCTCACAATTACATAACTAAGGG + Intergenic
959036980 3:101378086-101378108 TCTTACCACCACATTCCTAAAGG + Intronic
961742585 3:129042083-129042105 CCTTCCCACCACATCACTAAAGG + Intergenic
961932477 3:130548269-130548291 CCTTACCACCACATTACCAAAGG - Intergenic
962001879 3:131306331-131306353 ACTTACTGCAACATTACTAAAGG - Intronic
962899531 3:139746931-139746953 CCTTCCTACCACATTACTAAAGG + Intergenic
963232684 3:142924966-142924988 TCTTACCACCACCTAACTAAAGG - Intergenic
963261747 3:143199149-143199171 CCTTACAAATAAATTAGTAAAGG - Intergenic
963412302 3:144945670-144945692 CCTTACCACCACATCAATAGGGG - Intergenic
963573862 3:147033775-147033797 CCTTACCACCATATTACTAAAGG + Intergenic
964369358 3:155983716-155983738 CCTTATCACCACATCACTAAAGG - Intergenic
964608217 3:158581588-158581610 CCTTACCACTACATTACTAAAGG + Intronic
964852585 3:161110638-161110660 CCTTACCATCACATTACTAAAGG + Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967430860 3:189383594-189383616 CCTAACCACTACATTACTAAAGG - Intergenic
967871944 3:194236968-194236990 CCTTACCACCACATCACCAAAGG + Intergenic
968439585 4:616535-616557 TCTTACAACCACATCACTAAAGG - Intergenic
971577349 4:28292298-28292320 CTTGACCACCACATTGCTAAAGG + Intergenic
971697752 4:29928801-29928823 CCTTATTACCACATTTCTTATGG + Intergenic
971967248 4:33576510-33576532 CCTTACCTCTTCATTACTAAAGG - Intergenic
972175598 4:36402057-36402079 CCTTACCGGCACATCACTAAAGG - Intergenic
974189477 4:58486224-58486246 TCTTCCTACCACATTACTAAAGG - Intergenic
975386662 4:73767089-73767111 CCTTTCAAGGACATTCCTAAAGG - Intergenic
976555281 4:86443643-86443665 TCTTACCACCACATCAGTAAAGG + Intronic
976888689 4:90017113-90017135 CCTCACTACCACATTATTAAAGG + Intergenic
977111484 4:92962289-92962311 CCTTACCACCACATTACTAAAGG - Intronic
977616413 4:99091530-99091552 TCTTACCACTACATTACTAAAGG + Intergenic
977964380 4:103126455-103126477 CCTTGCCACTACATTACTAAAGG + Intronic
978658014 4:111089245-111089267 CCTTACTACCACATCACTAGAGG + Intergenic
979039005 4:115763011-115763033 CCTTACCACCACATTACTAAAGG + Intergenic
979790156 4:124770118-124770140 TCTTACAACCACATAACAAATGG + Intergenic
979824448 4:125216060-125216082 CCTCACTAGCACATTACTTATGG - Intergenic
981274316 4:142880087-142880109 CCTCACTGCCACATTTCTAAAGG + Intergenic
982403780 4:154998351-154998373 CCCTACAACCACATTACTAAAGG - Intergenic
982627366 4:157784966-157784988 CCTTACCACCATGTTACTAAAGG - Intergenic
982922057 4:161288100-161288122 CCTTACCACCACATTACTAAAGG + Intergenic
983075400 4:163319626-163319648 CCTTCCCACTACATTACTAAAGG - Intergenic
983430185 4:167639815-167639837 CCTCACCACTTCATTACTAAAGG - Intergenic
983579592 4:169294040-169294062 CCATACCACCACATTACTAAAGG + Intergenic
984148931 4:176101332-176101354 TCTTACCACTACATTACTAAAGG + Intronic
984298151 4:177880707-177880729 CCTTACCACCACATTACCAAAGG - Intronic
984636708 4:182118964-182118986 CCTGACCACCACATCGCTAATGG - Intergenic
984861328 4:184242904-184242926 CCTCACCACAACATTACTAAAGG - Intergenic
986183425 5:5415487-5415509 CCTTAAATGAACATTACTAAGGG - Intergenic
986850331 5:11804557-11804579 GCTTAAACCCTCATTACTAAGGG + Intronic
987478399 5:18421009-18421031 CCTTACCACCACATGACTAAAGG + Intergenic
987884375 5:23794608-23794630 TCTCACAACCACATTACTAAAGG - Intergenic
988094721 5:26590939-26590961 TCTTAGAACCACATTATTAAAGG - Intergenic
988648024 5:33117508-33117530 ACTTACCACCACATTACTGAAGG - Intergenic
989381647 5:40814754-40814776 CCTTAAATGCACATTGCTAAGGG - Intergenic
989723978 5:44565557-44565579 CCTCACTACCACATTGCTAAAGG - Intergenic
990035888 5:51319439-51319461 TCTTACCACTAAATTACTAAAGG - Intergenic
990096737 5:52123582-52123604 CCTTATAATTACATCACTAATGG + Intergenic
990571344 5:57082196-57082218 CCTTCCTACCACATCACTAAAGG - Intergenic
990625707 5:57608136-57608158 CTTTACCACCACATTGTTAAAGG + Intergenic
991007512 5:61844305-61844327 CCTTACCACTACATTACTAAAGG + Intergenic
991216244 5:64159938-64159960 CCCTATAACCATTTTACTAAAGG + Intergenic
991323298 5:65401156-65401178 CCTTATCACCACATTACTAAAGG - Intronic
991542550 5:67745872-67745894 ACTTACCACCACACCACTAAAGG + Intergenic
992033411 5:72746893-72746915 TCTTACTACCACATTACGAAAGG + Intergenic
993022073 5:82604054-82604076 CCTTACCACCACATTACTAAAGG + Intergenic
993389151 5:87297376-87297398 CCTTATAACTACATCACTAAAGG - Intronic
994381530 5:99077839-99077861 CCTTACCACCACGTTGCTAAAGG - Intergenic
994541249 5:101101278-101101300 CCTGACCACCACATTACTAAAGG - Intergenic
994633292 5:102312789-102312811 CCTTCCAACCACCTTATTAGTGG + Intergenic
994793240 5:104258927-104258949 CTTTAACACCACATTACTGAAGG + Intergenic
994915284 5:105968869-105968891 CCTTACAAAAACATTATTAATGG - Intergenic
994943498 5:106355984-106356006 TCTTACCACCACATTGCTAAAGG - Intergenic
995104126 5:108353862-108353884 CCTAACCACTACATTACTAAAGG + Intronic
996025087 5:118637034-118637056 CCTTACCACCACATTACTAAAGG - Intergenic
996233454 5:121095955-121095977 ACTTACCACCACATTACTAAAGG + Intergenic
996807651 5:127475595-127475617 CCTTACTACTACTTTACTAAAGG - Intergenic
998187061 5:139988502-139988524 CCTTAAATCCATATTGCTAAAGG + Intronic
998705757 5:144757933-144757955 ACTTACCACCACATTACTAAAGG + Intergenic
998961458 5:147491314-147491336 CCTTGCCACTACATTACTAATGG + Intronic
999715811 5:154359066-154359088 CCTTACAACACAAATACTAATGG - Intronic
1000657598 5:163900017-163900039 GATTACATTCACATTACTAAAGG + Intergenic
1001538229 5:172514782-172514804 CCTTACCACTACATTATTAAAGG + Intergenic
1004141357 6:13020825-13020847 CCTTACAGCCACTGTAATAAAGG - Intronic
1004487803 6:16083814-16083836 CCTTGAAACCACATTTCCAAAGG + Intergenic
1005596006 6:27380040-27380062 CCTTGATACCACATTTCTAAAGG + Intronic
1005625683 6:27659967-27659989 CTTTGCCACCACATTACTAAAGG + Intergenic
1006528729 6:34631226-34631248 CCTTACCATTACATTACTACTGG - Intronic
1008073950 6:47126631-47126653 GCTTACCACCACATTACTAAGGG - Intergenic
1008851875 6:56032429-56032451 CCTTACCAGCCCATTACTAAAGG - Intergenic
1009477174 6:64107781-64107803 CCTTACCACTACATTACTAAAGG - Intronic
1010319679 6:74491383-74491405 TCTTACTACCACATTACCAAAGG - Intergenic
1011265297 6:85511912-85511934 TTTTATCACCACATTACTAAAGG - Intronic
1012123949 6:95402909-95402931 CCGTTCAAGCACATAACTAAAGG + Intergenic
1012735856 6:102942246-102942268 CCTTACCATTACATTGCTAAAGG - Intergenic
1012925628 6:105264162-105264184 CCTTACCACCACATTACAAAAGG + Intergenic
1014086411 6:117351104-117351126 CCTTACCACCGCATTACTAAAGG - Intronic
1014203357 6:118628069-118628091 CCTTACCACCACATTACTAAAGG + Intronic
1014771492 6:125462935-125462957 TCTTACCACCACATTACTGAAGG - Intergenic
1015757392 6:136621531-136621553 GCTTCCCACCACATCACTAAAGG - Intronic
1015848033 6:137542181-137542203 CCTCACAACCATATTAATGAGGG - Intergenic
1015933868 6:138388733-138388755 CTTTACCTCCACATTACTAAAGG + Intergenic
1016580288 6:145622157-145622179 CATTATACCAACATTACTAAAGG - Intronic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1017335829 6:153258983-153259005 CCTTACCAACACTTTAGTAAAGG - Intergenic
1017336870 6:153271717-153271739 CCTTACTACCACATTAAGAAAGG - Intergenic
1018097344 6:160400553-160400575 CCTCACCACCACATTACTAAAGG + Intronic
1020587962 7:10095456-10095478 TCTTACTACTACATTACTAAAGG - Intergenic
1021043681 7:15894550-15894572 CCTTACCACCACATTTTTAAAGG + Intergenic
1021331747 7:19346820-19346842 CATTACCACCACAGTACTAAAGG - Intergenic
1022783833 7:33615127-33615149 CCTTACCACCACATTACTAAAGG + Intergenic
1023212006 7:37816118-37816140 CTTAACCACTACATTACTAAAGG - Intronic
1023412815 7:39904215-39904237 CACTACCACCACATTACTAATGG + Intergenic
1024388525 7:48781091-48781113 CCTTACCACCACATCAATAAAGG - Intergenic
1026071811 7:67128620-67128642 CCATACCATCACATTATTAAAGG - Intronic
1026705091 7:72683642-72683664 CCATACCATCACATTATTAAAGG + Intronic
1027817752 7:82998694-82998716 CCTTACCACCACATTACTAAAGG + Intronic
1027828496 7:83148064-83148086 CTTTACATCCACATTACAACAGG + Intronic
1028797118 7:94915743-94915765 CCTCATAACCACATCATTAATGG - Intronic
1028843168 7:95450727-95450749 CCTTACCGCCAGATCACTAAAGG - Intergenic
1030251429 7:107449621-107449643 ACTTCCAACAACATCACTAAGGG - Intronic
1030835191 7:114275800-114275822 CCTCACCATCACATTACTAAAGG - Intronic
1030857776 7:114582906-114582928 CTTTATATCCACAGTACTAAAGG - Intronic
1031686631 7:124738314-124738336 TCTTATCACAACATTACTAAAGG - Intergenic
1032641773 7:133777782-133777804 CCTTACAACAACCTTATAAAAGG - Intronic
1033014305 7:137656319-137656341 CATTATTACCAGATTACTAATGG - Intronic
1033985646 7:147222689-147222711 CCTTACCACCACATTACTAAAGG - Intronic
1035906643 8:3517861-3517883 GCTTACAACCCCATTCTTAAAGG + Intronic
1038785896 8:30616036-30616058 CCTTAAATACATATTACTAAGGG + Intronic
1039132060 8:34276168-34276190 ACCTACTACCACATTACTAACGG + Intergenic
1039312523 8:36333060-36333082 TCTGACCACCTCATTACTAAAGG + Intergenic
1039731137 8:40280157-40280179 CCACACCACCACATTACTAAAGG - Intergenic
1039758436 8:40547982-40548004 CCTGACAACCACATGCCAAATGG - Intronic
1039834047 8:41242105-41242127 CTTTACCACCACATTACTAAGGG - Intergenic
1040752153 8:50723562-50723584 CATGACAACCACATAACTACAGG + Intronic
1040754908 8:50761325-50761347 CCTTAACACAACATTACTGAAGG - Intronic
1041092890 8:54319048-54319070 CCTTGCCACCACAGCACTAAAGG + Intergenic
1041212142 8:55563360-55563382 CCTTACCTACACATTACTAAAGG - Intergenic
1041305360 8:56451839-56451861 CTTTATCAACACATTACTAAAGG + Intergenic
1041334800 8:56770064-56770086 CCTTACCACCACATTACTAAAGG - Intergenic
1041831371 8:62157997-62158019 CCTTACTAATACATGACTAAAGG + Intergenic
1041870174 8:62625204-62625226 CCTTACCACTACATTACTAAAGG - Intronic
1041892615 8:62888002-62888024 CCTTACCACCACATCGTTAAAGG - Intronic
1043046992 8:75338993-75339015 TCTCACCACCACATTACTAAAGG - Intergenic
1043071825 8:75645806-75645828 GCTTATAACCACATTTCTAAGGG + Intergenic
1043235167 8:77855734-77855756 CTTTACCACTACATTTCTAAAGG - Intergenic
1043412744 8:80015566-80015588 CCCTATCACCACATTACTAAAGG + Intronic
1044038754 8:87338857-87338879 CCTTACAACCACATTACTAAAGG - Intronic
1044260093 8:90109502-90109524 CCTTGCCACCACATTATTAAAGG - Intergenic
1044338076 8:91013261-91013283 CCTTGTAGCCACATTACAAAAGG - Intronic
1045620326 8:103970129-103970151 CCTTACCAGCACATTACTAAAGG - Intronic
1046854433 8:119015187-119015209 CCATATCACCACATTACTAAAGG - Intronic
1047664049 8:127070526-127070548 CCTAACTCCCACATTACTCAAGG + Intergenic
1048720558 8:137319482-137319504 CCATAAAACCAGATTACCAAAGG - Intergenic
1051048088 9:12899659-12899681 CTTTACTACCACATTACTAAAGG - Intergenic
1052081026 9:24205737-24205759 CTTTACTACCACATCACTAAAGG - Intergenic
1054358121 9:64084194-64084216 CCTTACCCCCACATTATTCATGG - Intergenic
1055760265 9:79599451-79599473 CCTTACATCAGCATTACTAGTGG - Intronic
1056087330 9:83163263-83163285 CCTAATCACCACATGACTAAAGG + Intergenic
1056388875 9:86121998-86122020 ACTTGCAACCACCTTTCTAAAGG + Intergenic
1057628803 9:96702165-96702187 TCTCACTGCCACATTACTAAAGG + Intergenic
1058281554 9:103122230-103122252 TCTTACCACCACAATACTAAAGG + Intergenic
1058491068 9:105500251-105500273 CCTTACTACCACATTAATAAAGG - Intronic
1058788710 9:108418796-108418818 CCTTACTACTACATTTTTAAAGG + Intergenic
1061829226 9:133280163-133280185 CCTTACATCCACCTTACCAAAGG - Intergenic
1203749958 Un_GL000218v1:68701-68723 CCTCATCACCGCATTACTAAAGG + Intergenic
1186487901 X:9947714-9947736 GCTAACAAGCACATTACTACTGG - Exonic
1187747230 X:22422599-22422621 ACTTTCAACCATATTACCAATGG - Intergenic
1188280427 X:28261074-28261096 TCTTACCACTACATTATTAAAGG + Intergenic
1189750183 X:44212660-44212682 CCTTACCATCACATCACTAAAGG + Intronic
1191802432 X:65095909-65095931 ACTTACAACCACATCACTAAAGG + Intergenic
1192380576 X:70612180-70612202 ATTCACCACCACATTACTAAAGG + Intronic
1192748337 X:73962773-73962795 TCTTACCACCACATCACTAAAGG - Intergenic
1194102856 X:89728605-89728627 CCTTACCATCACGTTACCAACGG - Intergenic
1195670709 X:107467481-107467503 CCTTATGACTACATCACTAAAGG + Intergenic
1196155979 X:112430968-112430990 CCTTACTGCTACATTACTAAAGG - Intergenic
1196202757 X:112904129-112904151 CTTTACCACCACATCACTAAAGG + Intergenic
1196418901 X:115503198-115503220 CCTTACCACTACATTACTAGAGG - Intergenic
1197030993 X:121815846-121815868 TCTTACCACCACATTACTAAAGG - Intergenic
1197539195 X:127734002-127734024 TCTTACCACCACATTGCTAAAGG + Intergenic
1197830729 X:130639460-130639482 CCTTACCACAATATTACTAAAGG + Intronic
1198446168 X:136716489-136716511 CCTTACCACCACATTACTAAAGG + Intronic
1198489081 X:137120217-137120239 CCTTAACACCACATTACTAAAGG + Intergenic
1199619148 X:149683842-149683864 CCTTACAACCACATTGATGGTGG + Intergenic
1200455537 Y:3386595-3386617 CGTTACCATCACATTACCAACGG - Intergenic
1201915845 Y:19180554-19180576 TCTTACATCCACTTTACCAAAGG + Intergenic