ID: 1044049073

View in Genome Browser
Species Human (GRCh38)
Location 8:87476967-87476989
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044049070_1044049073 27 Left 1044049070 8:87476917-87476939 CCAAGGACGCAAAGTAGCAGATA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1044049073 8:87476967-87476989 ATGTATAACAGGAGGACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr