ID: 1044052669

View in Genome Browser
Species Human (GRCh38)
Location 8:87527717-87527739
Sequence TACGGGATTTTAAGAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044052669_1044052679 20 Left 1044052669 8:87527717-87527739 CCCCTTGCTCTTAAAATCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1044052679 8:87527760-87527782 AGATAGGTGTACACACTCAGTGG No data
1044052669_1044052680 21 Left 1044052669 8:87527717-87527739 CCCCTTGCTCTTAAAATCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1044052680 8:87527761-87527783 GATAGGTGTACACACTCAGTGGG No data
1044052669_1044052676 4 Left 1044052669 8:87527717-87527739 CCCCTTGCTCTTAAAATCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1044052676 8:87527744-87527766 CAACATGGAGTAGCCCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044052669 Original CRISPR TACGGGATTTTAAGAGCAAG GGG (reversed) Intronic
908498882 1:64723114-64723136 TACTGAAATTTAGGAGCAAGTGG + Intergenic
911243471 1:95490913-95490935 TAGGGGATTATCAGAGAAAGAGG + Intergenic
914962915 1:152222330-152222352 TACTTCATTTTAAGAGCAATTGG + Intronic
921716598 1:218423380-218423402 TACGGGATTTGCTGAGCATGTGG - Intronic
923428682 1:233897812-233897834 AACGTGATTTTAAAAGCAAGGGG + Intergenic
923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG + Intronic
924315517 1:242791382-242791404 TACTGGTTATTAAGAGGAAGTGG + Intergenic
1064211961 10:13367154-13367176 TACAGGAATTTCAGAGCAGGAGG - Intergenic
1074313255 10:112340664-112340686 TAGGAGCTTATAAGAGCAAGAGG - Intergenic
1075166929 10:120077054-120077076 AACGGCATTTTCAGAGGAAGTGG + Intergenic
1078118417 11:8480123-8480145 TACGTGATTTGAAGAGACAGTGG + Intronic
1082682480 11:56193243-56193265 TACAGGTTTGTAGGAGCAAGAGG + Intergenic
1084601719 11:70149771-70149793 CACGGGCTTTGAAGAGGAAGAGG + Exonic
1098638721 12:72815178-72815200 TTCTGGATTTTAACAGGAAGTGG + Intergenic
1107470425 13:40686461-40686483 TAACAGATTTTAAAAGCAAGAGG - Intergenic
1117457667 14:55913980-55914002 TATGGGATATTAAGAGGCAGTGG + Intergenic
1117472710 14:56062587-56062609 TGCAGGATTGCAAGAGCAAGAGG + Intergenic
1119113066 14:71993830-71993852 TACTGGATTAGAAGAGCACGAGG + Intronic
1120200102 14:81528642-81528664 CAGGTAATTTTAAGAGCAAGAGG - Intronic
1123824540 15:24068191-24068213 TACGGGAATTGAAAAGCACGTGG + Intergenic
1128225420 15:65998105-65998127 GCTGGGATTTTAAGAGCAATGGG + Intronic
1130027451 15:80282073-80282095 TAGTGGATTTTAAGAGCTTGGGG + Intergenic
1130912759 15:88282400-88282422 TACAGGACTTTAAGACCCAGTGG + Intergenic
1138629733 16:58283860-58283882 GGCAGGATTTTTAGAGCAAGGGG - Intronic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1149234612 17:54575274-54575296 AATGGTAATTTAAGAGCAAGTGG - Intergenic
1161960674 19:7521235-7521257 TATGGGCTTTGAAGAGCAAGGGG - Intergenic
1162852038 19:13438405-13438427 AATGGGATTCTAAGAGAAAGAGG - Intronic
1164537974 19:29100512-29100534 TCCAGGATTCTAAGAACAAGGGG - Intergenic
1167067455 19:47197228-47197250 TACGGAACTTTAAGAGCACTGGG - Exonic
926388772 2:12365519-12365541 TAAGGGATTTAAACAGCATGGGG - Intergenic
926995981 2:18736384-18736406 GACAGGGTTTTAAGAGCAACTGG - Intergenic
936183876 2:110288490-110288512 GACGGGGTTTTGAGAGCAACCGG + Intergenic
939674857 2:145059991-145060013 CTCAGGATTTTAAAAGCAAGGGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
945587502 2:211684859-211684881 CTGGGGTTTTTAAGAGCAAGGGG - Intronic
1170438020 20:16350339-16350361 CACGTGCTTCTAAGAGCAAGGGG + Intronic
1181920799 22:26319063-26319085 TACGGGCTTGTAAGAGCTAATGG - Intronic
954887948 3:53893151-53893173 AACTGGATTTTAAGAGCAATAGG - Intergenic
956161432 3:66357494-66357516 TAAGGAATTTAAAAAGCAAGGGG - Intronic
956870895 3:73416750-73416772 AACAGAGTTTTAAGAGCAAGTGG - Intronic
959177768 3:102938046-102938068 TACTGGATGCCAAGAGCAAGTGG - Intergenic
960611981 3:119562965-119562987 GACAGCATTTTAAGAGGAAGAGG - Intergenic
963985859 3:151593858-151593880 TAGGGGATTTTGAGAGAAAAGGG + Intergenic
964278443 3:155034428-155034450 AACTTGATTTTAGGAGCAAGAGG + Intronic
964804944 3:160598569-160598591 TACGGGATATTAAGGCCAATCGG + Intergenic
965066502 3:163857034-163857056 TATGGGATTTTTAGGGCAATGGG + Intergenic
965482642 3:169238717-169238739 TAAGAGATCTTAAGAGAAAGTGG - Intronic
966678577 3:182616220-182616242 TGGAGGATTTGAAGAGCAAGGGG + Intergenic
967734512 3:192938064-192938086 TATTGGATTCTGAGAGCAAGGGG - Intergenic
974208847 4:58743332-58743354 GACGGGGTTTTGAGAGCAACCGG + Intergenic
978922867 4:114205763-114205785 TACGGGATTTTTATTTCAAGAGG + Intergenic
988197467 5:28023961-28023983 TAGGGTATTTAAAGAGCAAGTGG + Intergenic
989473660 5:41849850-41849872 TACGTGATTTTAAATGCTAGTGG + Intronic
991928287 5:71726764-71726786 AACGTGATTTAAAGAACAAGAGG - Intergenic
996756286 5:126938916-126938938 TACCTGATTTTAATAGCAAAAGG - Intronic
1001016102 5:168142708-168142730 GTCAGGATTTTAAGAGAAAGGGG - Intronic
1001694228 5:173658107-173658129 TATTGGATTTTACGAGCTAGTGG - Intergenic
1004019029 6:11759760-11759782 TTAAGGATTTTAAGAGTAAGAGG + Intronic
1007872025 6:45051195-45051217 TATGGGAGTTTAAGAACAAGTGG + Intronic
1015800169 6:137052426-137052448 TAGGGGATTGTTACAGCAAGAGG - Intergenic
1019650144 7:2152407-2152429 TGCGGGTTTTTCAGCGCAAGAGG - Intronic
1024775579 7:52781635-52781657 CATGGCCTTTTAAGAGCAAGTGG + Intergenic
1026863811 7:73810684-73810706 TAGGGGACTTTAAGAGGGAGGGG - Intronic
1028031405 7:85918791-85918813 TAAGGTATCTTTAGAGCAAGGGG + Intergenic
1028902835 7:96120338-96120360 AAGTGGATTTTAAAAGCAAGTGG + Exonic
1030638155 7:111973467-111973489 TGCAGGAATTTAAGAGGAAGAGG + Intronic
1038541423 8:28393300-28393322 TCAGGAATTTTAAGAGAAAGTGG + Intronic
1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG + Intergenic
1042356077 8:67829298-67829320 TATAGAAGTTTAAGAGCAAGTGG - Intergenic
1043551112 8:81374105-81374127 TTCGGGATGAAAAGAGCAAGGGG - Intergenic
1044052669 8:87527717-87527739 TACGGGATTTTAAGAGCAAGGGG - Intronic
1045002149 8:97887947-97887969 AACGGCATTTTGAGTGCAAGTGG + Intronic
1047115140 8:121833531-121833553 TAAGGGATTTTAAGAGTGATGGG + Intergenic
1052026238 9:23576585-23576607 TATGTGCTTTCAAGAGCAAGTGG - Intergenic
1056861488 9:90188128-90188150 TACAAAATTTTAAAAGCAAGAGG + Intergenic
1058509427 9:105700919-105700941 TACATGATTTAAAGAGCCAGAGG + Intronic
1058877317 9:109255728-109255750 CACAGGATTTTCACAGCAAGGGG + Intronic
1061760051 9:132844586-132844608 GACAGGATTTCAAGAGTAAGAGG - Intronic
1185977320 X:4735978-4736000 TAATGGATTTTAGGAGGAAGAGG + Intergenic
1187999065 X:24961489-24961511 TATGTGATTTTAAGAACAACGGG - Intronic
1188767226 X:34109172-34109194 TATGGTATTTTAAAAGCATGTGG + Intergenic
1189005693 X:36992095-36992117 TACAGGGTTTTATGAGCAACTGG + Intergenic
1189043292 X:37565550-37565572 TACAGGGTTTTATGAGCAACTGG - Intronic
1194416611 X:93620005-93620027 TAAGGGATCTTTAGAGCATGAGG + Intergenic
1195284804 X:103373851-103373873 TCATGGATTTTAAGAACAAGTGG + Intergenic
1195763831 X:108275525-108275547 TCAGGGATTTCAAAAGCAAGAGG - Intronic
1197871984 X:131069550-131069572 TATGGGAGTTTAAAAGAAAGGGG + Intronic
1201219146 Y:11749741-11749763 TACTGGTTATTAAGAGGAAGTGG + Intergenic