ID: 1044052677

View in Genome Browser
Species Human (GRCh38)
Location 8:87527757-87527779
Sequence CTGAGTGTGTACACCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044052677_1044052682 25 Left 1044052677 8:87527757-87527779 CCCAGATAGGTGTACACACTCAG 0: 1
1: 0
2: 2
3: 9
4: 112
Right 1044052682 8:87527805-87527827 CCCAGAGCTTAGAAAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044052677 Original CRISPR CTGAGTGTGTACACCTATCT GGG (reversed) Intronic
910986973 1:93014734-93014756 CTGGGGGTGAACAGCTATCTTGG - Intergenic
912204159 1:107492296-107492318 CTGAGTGCCTACACCTAGCCTGG + Intergenic
916193059 1:162197832-162197854 CTGAGAGTGTCCAACTCTCTTGG + Intronic
918821287 1:189258358-189258380 CTGAGTATGTACACGTGTCATGG - Intergenic
922459744 1:225806498-225806520 TTCAGTGTGTACACATATATAGG - Intergenic
923732187 1:236562685-236562707 CTGAGTTTCTAGACCAATCTGGG + Intronic
1069756440 10:70776765-70776787 CTGAGTGTGGACACCAGGCTGGG + Intronic
1073650355 10:105352228-105352250 CTGAGTGTGTGTTCCTAGCTAGG + Intergenic
1074178620 10:111036135-111036157 ATGAATGTGTTCACCTATATTGG - Intergenic
1076535864 10:131176945-131176967 CTCTGTGTGTACACGTGTCTTGG - Intronic
1076535866 10:131176983-131177005 GTCTGTGTGTACACCTGTCTTGG - Intronic
1076648099 10:131967957-131967979 CTGAGTTTGTAGCTCTATCTTGG + Exonic
1078955480 11:16189431-16189453 GTGTGTGTGTACACATATGTTGG + Intronic
1085620765 11:78036471-78036493 GTGAGTGTCTTCACCTCTCTGGG - Intronic
1088592303 11:111414362-111414384 CTGAGTGGGTCCACCTACATGGG + Intronic
1088842989 11:113642209-113642231 CAGAGTGTGTACTCCTAACCAGG - Intergenic
1089659849 11:119978705-119978727 CTGCTTGTGGGCACCTATCTGGG - Intergenic
1089981298 11:122774875-122774897 CTGAGGGTGTAGACACATCTGGG - Intronic
1092044855 12:5424058-5424080 CTAGGTGTGCACACCTTTCTAGG - Intergenic
1094232166 12:28118903-28118925 CTGCGTGTGTACATATATATGGG - Intergenic
1096296753 12:50390650-50390672 CTGAATTTGTAAACCTAACTGGG - Intronic
1097133082 12:56827965-56827987 CTGAGTGAGTACACTTTTCCTGG + Intergenic
1101643501 12:106606288-106606310 CTGGGTGTGTATACCTATCTAGG + Intronic
1104769313 12:131351126-131351148 CTGAGTGTGAACACCTGCCTGGG - Intergenic
1104769350 12:131351300-131351322 CTGAATGTGAACACCTTCCTGGG - Intergenic
1104769388 12:131351476-131351498 CTGAGTGTGAACACATGCCTGGG - Intergenic
1112234455 13:97623055-97623077 GTGAGTGTGTACACTTATATAGG + Intergenic
1112755935 13:102633698-102633720 CTGTGTGTATATACATATCTGGG - Intronic
1114614639 14:24061888-24061910 ATGTGTGTGTACACCTGTGTGGG - Intronic
1114989183 14:28265681-28265703 CTGAGTTTGTAGCTCTATCTTGG - Intergenic
1119430115 14:74561748-74561770 GTGAATGTGTACACATAACTAGG + Intronic
1122234474 14:100323912-100323934 CTGGGTGTGTGCACCTGGCTAGG + Intronic
1124601365 15:31135205-31135227 CAGAATGTGTGCACATATCTAGG - Intronic
1128978291 15:72168802-72168824 CTGAGTGTGTATCCCTTCCTGGG - Intronic
1131756708 15:95571792-95571814 CTGAGTGAGTTCACCCATTTGGG - Intergenic
1133732010 16:8586105-8586127 CTGAATGTGCACACCCAGCTTGG + Intronic
1141269739 16:82528339-82528361 CTGGGTTTGTTCACCTGTCTGGG + Intergenic
1141520923 16:84578698-84578720 CTGTGTGTGTGCACCTGTGTGGG - Intronic
1146920353 17:36705891-36705913 CTGTGTGTAAGCACCTATCTGGG - Intergenic
1147421086 17:40322519-40322541 CTGTGTGTACACACCTACCTTGG + Intronic
1150234502 17:63581977-63581999 CTGAGTGTGTAATGCTCTCTCGG - Intronic
1150461864 17:65360345-65360367 GTGAGTGTGTACAGCTGTGTAGG + Intergenic
1150952737 17:69821519-69821541 CTGTGTGTGCACACCTAGCCAGG - Intergenic
1152105491 17:78326274-78326296 CTGAGGGTCTGCACCTATCGTGG - Intergenic
1156090125 18:33456905-33456927 GTGTGTGTGTACAGCTTTCTGGG - Intergenic
1158762242 18:60403568-60403590 CTGGGTGGGTACCTCTATCTAGG + Intergenic
1158838181 18:61353993-61354015 CTGAGTGTGTGGCCCAATCTTGG - Intronic
1159183813 18:64944706-64944728 CTAGGTGGGTACACCTGTCTGGG - Intergenic
1166244942 19:41518671-41518693 CAGAGGGTGTACACTTATCCTGG - Intergenic
1166569904 19:43787792-43787814 CTGTGTGTCTATTCCTATCTTGG + Intergenic
925081688 2:1074060-1074082 CTGAGTCTGGGAACCTATCTGGG - Intronic
925489188 2:4373119-4373141 CTGAATGTGTACTCCAAGCTAGG + Intergenic
926794182 2:16605492-16605514 CTGAGAGTGTCCACCTGCCTAGG - Intronic
928773524 2:34731367-34731389 CTGACTGTGAACACCTACTTGGG - Intergenic
932461819 2:71887060-71887082 TTGAATGTGGACACCTATCGTGG + Intergenic
932707702 2:74039372-74039394 CTCAGTATATACAGCTATCTGGG - Intronic
935311173 2:101785094-101785116 CTGTGTGTGTGCACCCCTCTGGG + Intronic
939143234 2:138379757-138379779 CTGGGTGTGCCCGCCTATCTGGG - Intergenic
941498690 2:166240933-166240955 ATGAGTGTGTACACATATAGTGG - Intronic
948220172 2:236263039-236263061 GTGCGTGTGTGCACCTATGTTGG + Intronic
949011042 2:241678619-241678641 CTGGCTGTTTACACCAATCTAGG + Exonic
1168914249 20:1473451-1473473 ATGTGTGTGTGCACCTATGTGGG - Intronic
1169540756 20:6597032-6597054 CGGAGTTTGTACACCTGGCTTGG + Intergenic
1170210832 20:13844919-13844941 CTGAGTGAGTAAACCTGTCTTGG + Intergenic
1171032097 20:21686031-21686053 CTCAGTGTGTGCTCCCATCTGGG + Intergenic
1171419596 20:25008939-25008961 CTGAGTGTGGAAACCTGCCTAGG + Intronic
1177808996 21:25904659-25904681 CTGAGAGTCTACATCTATCTGGG + Intronic
1185232917 22:49693653-49693675 CTGTGCGTGTACACATATGTGGG + Intergenic
949143708 3:668855-668877 GTGAGTGTGTACATTTATTTAGG - Intergenic
950730481 3:14952340-14952362 CTGAGTGTCTCCACATATCGAGG + Intronic
953475472 3:43202289-43202311 TTGAGTGTGTCCATCTGTCTTGG - Intergenic
953871688 3:46632296-46632318 ATGGGTGTGTGCACCCATCTTGG + Intergenic
954857856 3:53662117-53662139 TTGACTGTTTACACTTATCTTGG + Intronic
956982038 3:74650328-74650350 CTGAGTGTTGAGGCCTATCTTGG - Intergenic
957358175 3:79118523-79118545 CTGAGTGTGTTTACTTACCTAGG + Intronic
959223140 3:103548108-103548130 CTAAATGCATACACCTATCTTGG + Intergenic
963318044 3:143782106-143782128 CTGTGTCTGTGCACATATCTGGG - Intronic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
970863023 4:20725340-20725362 GTGTGTGTGTACACCTATGGGGG - Intronic
971025835 4:22587397-22587419 CAGAGGGTGTACACCCTTCTTGG - Intergenic
973775123 4:54234731-54234753 CTGAGTGAGGAGACCTATGTCGG + Intronic
982672753 4:158341581-158341603 CTGTGTGTGTATACATATGTGGG - Intronic
986034425 5:3924478-3924500 CTGAGTGTGTTCACATGTGTGGG + Intergenic
986429697 5:7669358-7669380 CTGAGTTTGTACACAAAGCTCGG + Intronic
987443842 5:17991791-17991813 CTCTGTGTGTCCACCTAACTAGG + Intergenic
988134535 5:27152925-27152947 CTATGTGTGTACACATGTCTAGG + Intergenic
988282645 5:29170286-29170308 CTGAGTATGTACTCTGATCTTGG + Intergenic
990117453 5:52406106-52406128 CTGAGTGTGTTCAAGTATCTTGG - Intergenic
1000549234 5:162638567-162638589 GTTTGTGTGAACACCTATCTTGG - Intergenic
1001202109 5:169727622-169727644 CTTAGTGTGTACACCTACTGGGG - Intronic
1007605671 6:43116198-43116220 CACAGTGTCTCCACCTATCTAGG - Intronic
1007619748 6:43204683-43204705 CTGGGTGAGTACACCGGTCTTGG - Intronic
1011284242 6:85706491-85706513 CTGAGTGTGCACACCCAGCCAGG + Intergenic
1012519807 6:100107698-100107720 CTGGGTGTGTACGCATATGTAGG + Intergenic
1013193341 6:107822939-107822961 CTTAGTGTGTTAAACTATCTGGG - Intronic
1013331266 6:109102784-109102806 CTGAATCTGTACAACTATATTGG + Intronic
1019423761 7:963579-963601 CTGAGTGGGGACACCTGTCGAGG + Intronic
1020335972 7:7062686-7062708 CAGAGGGTGTACACCCTTCTTGG + Intergenic
1020864407 7:13539279-13539301 ATGAGTGTGCACACATAGCTGGG - Intergenic
1020920680 7:14260075-14260097 GTGTGTGTGTACACATATGTAGG - Intronic
1021736741 7:23646826-23646848 CTGAGGATGAACACCTATTTTGG - Intergenic
1023749518 7:43358322-43358344 CTGAGTGTGTAGACCTAACATGG + Intronic
1024409062 7:49017971-49017993 CTGAATGTATACACCAATTTGGG - Intergenic
1024534977 7:50422931-50422953 CTGAGTGTGTACATGTAGCTGGG - Intergenic
1024994119 7:55258260-55258282 CGGAATGTATACACCTATTTGGG + Intergenic
1028631180 7:92935728-92935750 CTGAGTGTGCACTCCAACCTGGG - Intergenic
1028656192 7:93210123-93210145 CTGAATGAGAAAACCTATCTAGG - Intronic
1030167173 7:106566930-106566952 CTGTGTGTGTACATCTGTATGGG - Intergenic
1030645497 7:112056552-112056574 CTGAGTGTGAACACTTCCCTTGG - Intronic
1037713855 8:21379736-21379758 CTGGGTGTGTGCAGCTATTTTGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042760807 8:72269622-72269644 CTAATTGAGTACACCTATCCAGG + Intergenic
1044052677 8:87527757-87527779 CTGAGTGTGTACACCTATCTGGG - Intronic
1046820835 8:118632600-118632622 CTGGGTGTTTACACCAATCAAGG + Intergenic
1049161296 8:141099598-141099620 TTGTGTGTGTTCAGCTATCTGGG + Intergenic
1049429727 8:142555171-142555193 CTGCGTGTGTTCAGCTATCTGGG - Intergenic
1049978358 9:881647-881669 CTGACTGTGTACATGTATTTAGG - Intronic
1051735518 9:20194394-20194416 CTGAATGTGTACAGTAATCTTGG - Intergenic
1053187791 9:36033601-36033623 GGGAGAGTGTACAACTATCTGGG + Intergenic
1053234286 9:36438656-36438678 CTGAGTGTGCTAACCTATCTAGG - Intronic
1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG + Intergenic
1185847095 X:3447817-3447839 CTGAGTGTGTACACCTGTGTGGG + Intergenic
1188250151 X:27883235-27883257 CTGATTGTGTAGACCTTGCTGGG + Intergenic
1196370334 X:114971220-114971242 CTGAGCATGTACACATCTCTGGG - Intergenic