ID: 1044055351

View in Genome Browser
Species Human (GRCh38)
Location 8:87562942-87562964
Sequence ATGCTATCATTGAGGAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 1, 2: 10, 3: 72, 4: 459}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044055351_1044055355 10 Left 1044055351 8:87562942-87562964 CCCGTTTTCCTCAATGATAGCAT 0: 1
1: 1
2: 10
3: 72
4: 459
Right 1044055355 8:87562975-87562997 TATAGTAAAATATCACAATTGGG No data
1044055351_1044055354 9 Left 1044055351 8:87562942-87562964 CCCGTTTTCCTCAATGATAGCAT 0: 1
1: 1
2: 10
3: 72
4: 459
Right 1044055354 8:87562974-87562996 CTATAGTAAAATATCACAATTGG No data
1044055351_1044055356 23 Left 1044055351 8:87562942-87562964 CCCGTTTTCCTCAATGATAGCAT 0: 1
1: 1
2: 10
3: 72
4: 459
Right 1044055356 8:87562988-87563010 CACAATTGGGACATTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044055351 Original CRISPR ATGCTATCATTGAGGAAAAC GGG (reversed) Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
902138280 1:14329859-14329881 ATGCTAGAAGTGAAGAAAACAGG - Intergenic
903564105 1:24251657-24251679 ATGTTATCATTGTGGGAAGCTGG - Intergenic
903797247 1:25938659-25938681 ATGTTATATTTGGGGAAAACTGG - Intergenic
904589383 1:31601790-31601812 ATGTTACCATTGAGGGAAAGGGG - Intergenic
904891347 1:33781974-33781996 ATGCTTTCAATGAGGAAGAAAGG + Intronic
905736038 1:40326620-40326642 ATGCTATCACTGAGACAAATTGG - Intergenic
907543980 1:55243214-55243236 ATGCTAACATTGGGGAGAAGGGG + Intergenic
908745522 1:67372649-67372671 ATGCCATCACAGAGGAAAAGGGG + Exonic
908983320 1:69984956-69984978 ATGCTATGTTTGAGGAAGAGTGG - Intronic
909504774 1:76376203-76376225 ATGTTATCATTGGAGAAAACTGG - Intronic
909744011 1:79070229-79070251 ATGTTACCATTGAGGAAAAATGG + Intergenic
911362043 1:96889006-96889028 ATGCTATCTTTGAGAAATATAGG - Intergenic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
913084185 1:115420228-115420250 ATGTCACCATTGGGGAAAACTGG - Intergenic
913457469 1:119048520-119048542 ATGTTGCCATTGAGGGAAACTGG - Intronic
913574487 1:120157190-120157212 ATGCTGTCAAAGAGGAAAAAAGG + Exonic
914295756 1:146321994-146322016 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914556795 1:148772792-148772814 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914616039 1:149357438-149357460 ATGCTGTCAAAGAGGAAAAAAGG - Intergenic
915710753 1:157895866-157895888 ATGTTACAATTGAGGAAAACTGG - Intronic
916204462 1:162301724-162301746 ATTCTCCCAATGAGGAAAACAGG - Intronic
916255623 1:162784788-162784810 ATGTTATAAATGGGGAAAACTGG - Exonic
917029545 1:170673721-170673743 ATGTTACCATATAGGAAAACAGG - Intronic
917705535 1:177630335-177630357 ATGTTACTATTAAGGAAAACTGG + Intergenic
917923942 1:179773460-179773482 ATGTTACCATTGGGGGAAACTGG + Intronic
918594920 1:186281945-186281967 ATGTTAGCATTTAGGAAATCTGG + Intergenic
919951820 1:202371750-202371772 ATGTTAACATTCAGGAAAGCTGG - Intronic
920033995 1:203053940-203053962 ATGCCATCAATGAGGAAATCAGG + Exonic
921105847 1:211977216-211977238 ATGCTATCAGCAAGGTAAACAGG + Intronic
921241043 1:213182996-213183018 ATGCAAACATTAAAGAAAACAGG + Intronic
921399158 1:214701615-214701637 ATGTTATCATTGGCGGAAACCGG - Intergenic
923720797 1:236465062-236465084 ATGCGATCACTGGGGAAAACAGG - Intronic
923773138 1:236955240-236955262 ACCCAATCAGTGAGGAAAACAGG - Intergenic
924061430 1:240178866-240178888 ATGTTACCATTTAGGAAAATCGG - Intronic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924310339 1:242734821-242734843 ATGTTATCATTGAGGGAAACTGG + Intergenic
924668700 1:246100867-246100889 ATATTATCATGGAGAAAAACAGG + Intronic
1063715921 10:8527027-8527049 GTGCTATGAATGAGGACAACAGG + Intergenic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1065227568 10:23560371-23560393 ATGTTATCATTGGGTGAAACTGG - Intergenic
1066658205 10:37713720-37713742 ATGTTATCACTGAAGGAAACTGG - Intergenic
1067100695 10:43332336-43332358 ATGTTATCATTGGGGGAAACTGG + Intergenic
1067108588 10:43382541-43382563 ATGAAATCATTTAGGAACACAGG + Intergenic
1067241940 10:44504899-44504921 ATGTTACCATTGGGGGAAACTGG + Intergenic
1067985144 10:51135601-51135623 GTCTTATCATTGAGGAAAACTGG - Intronic
1068119024 10:52767066-52767088 ATACAATCACTTAGGAAAACTGG + Exonic
1068257462 10:54531856-54531878 TTGCTATCATAGCCGAAAACTGG + Intronic
1068833780 10:61528700-61528722 ATGCTATCATTGGGGGGAAATGG + Intergenic
1071932652 10:90490264-90490286 ATGTTAACATTAGGGAAAACTGG - Intergenic
1072417206 10:95259171-95259193 ATGTTACCATTGAGGGAAATTGG + Intronic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1072981524 10:100101874-100101896 ATGACATCAATGAGGATAACAGG + Intergenic
1073197015 10:101699953-101699975 ATGCTATTATAGAGGAATAATGG - Intergenic
1073376186 10:103036998-103037020 ATGTTACCATTGGGGGAAACTGG + Intronic
1073813435 10:107177352-107177374 ATGTTACCATTGGGGGAAACTGG - Intergenic
1073980890 10:109152310-109152332 ATGTTACCATTGGGGAAAACTGG - Intergenic
1074020934 10:109581880-109581902 GTGTTATCATTGAGGAGAAGAGG - Intergenic
1074149680 10:110747092-110747114 ATGTTATCATTGGGGAAGATAGG + Intronic
1074439450 10:113462582-113462604 ATGTTAGCATTGGGGAAAAGTGG - Intergenic
1074806603 10:117059814-117059836 ATTGTACCATTGAGGGAAACTGG + Intronic
1075095947 10:119471100-119471122 ATGCAAGCATTGGGGGAAACTGG + Intergenic
1075208202 10:120465121-120465143 ATGCTATCATTGAAAAATAGAGG - Intronic
1075309631 10:121402633-121402655 ATGTTACCATTGAGGAAAATTGG + Intergenic
1076081580 10:127586376-127586398 ATTCTATTAGTGAGGAAAATGGG + Intergenic
1076517911 10:131059670-131059692 ATGTTACCATTGAGAGAAACAGG + Intergenic
1077697798 11:4410789-4410811 ATGTTAACATTAAGGAAAATGGG + Intergenic
1078110129 11:8385527-8385549 GTGCTATCATAGAGGATTACAGG - Intergenic
1078433696 11:11307507-11307529 TTGCTATCAAACAGGAAAACTGG + Intronic
1078449559 11:11430304-11430326 ATGTTACCATTGGGGAATACTGG - Intronic
1078792027 11:14553230-14553252 ATGTTACCATTGGGGGAAACAGG - Intronic
1078949685 11:16116581-16116603 ATGTTATCATTTGGGGAAACTGG - Intronic
1079029371 11:16974513-16974535 ATGTTATCACTGAGGGAAGCTGG - Intronic
1079095674 11:17508588-17508610 ATGCAATCTCTGAGGAAGACAGG - Intronic
1079152429 11:17912451-17912473 ATTCTATCATTGAGGGAAGCTGG + Intronic
1079257142 11:18840887-18840909 CTGCTATCGCTGAGGAATACAGG + Intergenic
1079596033 11:22247776-22247798 ATGCTAAGATTGAGAAAAATGGG + Intronic
1079800818 11:24866341-24866363 ATCCCATCAGGGAGGAAAACTGG + Intronic
1080926257 11:36759660-36759682 ATGCTAACATTGAGAAACCCTGG + Intergenic
1081279975 11:41197336-41197358 ATCCTGACATTGAGGAAGACAGG + Intronic
1081443994 11:43111896-43111918 ATGTTATCATTGGGGGAAACTGG + Intergenic
1083066952 11:59934018-59934040 ATGTTACCATTGGGGAAAATTGG - Intergenic
1083917624 11:65759311-65759333 ATGTTATTGTTGAGGGAAACAGG - Intergenic
1083927346 11:65816120-65816142 AGGCTTTCATTTAGAAAAACCGG - Intergenic
1084017960 11:66397904-66397926 ATATTATCAATGGGGAAAACTGG - Intergenic
1085665545 11:78412630-78412652 ATGTTACCATTAAGGAAAACTGG + Intronic
1085842695 11:80030917-80030939 GTGCTAACGTTGAGAAAAACTGG - Intergenic
1086201563 11:84209525-84209547 ATGTTATCAATGTGAAAAACTGG + Intronic
1086470104 11:87099400-87099422 ATGCTACCATTGGGGGAAAATGG - Intronic
1087206228 11:95398356-95398378 ATGTTCTCATTGAGATAAACTGG + Intergenic
1087270960 11:96111234-96111256 TAGCTATCATGGAGGAAAAAAGG - Intronic
1087320112 11:96647641-96647663 ATGCTTTCATTGAGAAATACGGG - Intergenic
1087357556 11:97113879-97113901 ATTATATCATTGGAGAAAACGGG - Intergenic
1087412735 11:97812397-97812419 ATACCATATTTGAGGAAAACTGG - Intergenic
1087448067 11:98280652-98280674 ATGTTACCATTGGGGGAAACAGG - Intergenic
1087744481 11:101927415-101927437 ATGTTATCATTGGGGGAAACTGG - Intronic
1087816888 11:102668390-102668412 ATGTAATCATTGGGGAAAACTGG - Intergenic
1088601159 11:111477494-111477516 ATTCTATCTTTGAGGAAGATGGG + Intronic
1088966842 11:114731865-114731887 ATGTTACCATTGGGGGAAACTGG + Intergenic
1089122976 11:116153283-116153305 ATATTATCATTGGGGGAAACTGG + Intergenic
1089441363 11:118520272-118520294 ATACTATCATTAAAGAAAACAGG - Intronic
1089521100 11:119064186-119064208 ATGCGGTTATTGACGAAAACTGG + Intergenic
1089971598 11:122698072-122698094 ATTCTCTCAGTGAGGAAACCAGG + Intronic
1090179100 11:124678476-124678498 ATGCTATCATTTAACAAAAGAGG + Intronic
1090724014 11:129505787-129505809 ATGTTACCATTAGGGAAAACTGG - Intergenic
1090902813 11:131047428-131047450 ATGCTACCATAGAGGAATGCGGG + Intergenic
1092092519 12:5814438-5814460 ATGTAATATTTGAGGAAAACAGG - Intronic
1092988388 12:13869858-13869880 ATGCTATCATCGGTGAAACCAGG + Intronic
1093611868 12:21170779-21170801 ATGCTATCAATGAAGATAAAAGG - Intronic
1094274129 12:28650052-28650074 ATCCTGTCATTTAGGACAACAGG - Intergenic
1095272615 12:40237586-40237608 ATGGTATCATTGATGAAGACAGG + Intronic
1095675169 12:44908266-44908288 ATGATTTCATTGAGGAATAGAGG + Intronic
1095777966 12:46030504-46030526 GTGCAATCATTGAGGAAATGAGG + Intergenic
1096705204 12:53416768-53416790 ATGTTAACAATGAGGGAAACGGG - Intergenic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1099720195 12:86352463-86352485 ATGCTATCATTGTGAAAAGGAGG - Intronic
1099788040 12:87292647-87292669 ATGCTATAATTAATGCAAACAGG + Intergenic
1100307948 12:93368456-93368478 TTGCTATCTTTTGGGAAAACAGG - Intergenic
1101589074 12:106110503-106110525 ATGTGAGAATTGAGGAAAACTGG - Intronic
1101869533 12:108553347-108553369 GTGTTATCATTGAGGGAAACTGG + Intronic
1102582840 12:113902031-113902053 ATGTCACCATTGAGGGAAACTGG - Intronic
1105048033 12:133022561-133022583 ATGTTAGCATTGGGGGAAACTGG + Exonic
1105792219 13:23812708-23812730 ATGCTACCACTGGAGAAAACTGG + Intronic
1106015849 13:25868352-25868374 ATACGATACTTGAGGAAAACTGG - Intronic
1106442178 13:29785253-29785275 ATGTTACCATTAGGGAAAACTGG + Intronic
1107079910 13:36363861-36363883 GTGTTATCTTTGAGGAAAGCTGG - Intronic
1107134956 13:36933660-36933682 ATGCTACCACTGGGGGAAACTGG - Intergenic
1107195729 13:37649207-37649229 ATGCTTCCCTTGAGGTAAACAGG - Intronic
1107951910 13:45470609-45470631 ATGTTACCATTGAGGGAAAGTGG - Intronic
1108293078 13:48981363-48981385 ACAATATCTTTGAGGAAAACAGG - Intronic
1109156586 13:58918392-58918414 ATTCTACCAATGAGGAAATCAGG + Intergenic
1109773836 13:67013776-67013798 ATTCTATATTTGAGAAAAACAGG + Intronic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1110310029 13:74038176-74038198 ATGCTACCAGTGGGGAAAACTGG + Intronic
1110644775 13:77869601-77869623 ATGTTACCATTGGGGTAAACTGG - Intergenic
1111554163 13:89858085-89858107 CTGTAATCATTGAGGAAGACAGG + Intergenic
1112703744 13:102042239-102042261 ATGGTATCACTTAGTAAAACAGG + Intronic
1112905210 13:104409526-104409548 ATGCTATCATTTGGAGAAACTGG + Intergenic
1113862022 13:113492397-113492419 GTGCTACCATTGGAGAAAACAGG - Intronic
1115076418 14:29397694-29397716 ATGTTATCATTGGAGAAAACTGG - Intergenic
1117045829 14:51812283-51812305 ATCCTCTCTTTGAGGAAAAATGG + Intergenic
1117291290 14:54336199-54336221 ATGCTACCACTGAGGGAAACTGG + Intergenic
1117357763 14:54942369-54942391 ATGTTACCACTGGGGAAAACTGG - Intronic
1117701812 14:58421482-58421504 ATGTTACCATTGTGGAAAACTGG + Intronic
1118164704 14:63324901-63324923 ATGTTATCATTGAGGGAGACTGG + Intergenic
1118300264 14:64608877-64608899 ATGCTACCATTGGGAGAAACTGG - Intergenic
1118410748 14:65475259-65475281 ATGTTATTATAGAGGAAATCAGG - Intronic
1119685963 14:76631501-76631523 ATGTTACTATTGAGGGAAACAGG + Intergenic
1120133791 14:80839629-80839651 ATGTTACCATTGAGGCAAATTGG + Intronic
1120965366 14:90162486-90162508 ATGTTGCCATTGAGGAAAACTGG + Intronic
1121710594 14:96036084-96036106 ATGTTATCATTGGGAGAAACTGG + Intergenic
1124918677 15:34002066-34002088 ATGTTATCATTGGGGTAAACTGG - Intronic
1125460920 15:39905957-39905979 ATGCTACCACTGGGGGAAACTGG + Intronic
1127162091 15:56199508-56199530 ATGCTTGCATTAAAGAAAACAGG - Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128411928 15:67408122-67408144 ATGCTGTTATTGCGAAAAACTGG - Intronic
1128981358 15:72189456-72189478 ATGTTACCATTGGGGGAAACTGG + Intronic
1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG + Intergenic
1129737224 15:77973140-77973162 ATGCTGGCTTTGAGGAAAGCAGG - Intergenic
1129848854 15:78780495-78780517 ATGCTGGCTTTGAGGAAAGCAGG + Intronic
1130142610 15:81241706-81241728 ATGTTACCATTGGGGGAAACTGG - Intronic
1130253098 15:82313585-82313607 ATGCTGGCTTTGAGGAAACCAGG - Intergenic
1130545530 15:84855496-84855518 ATGATATCTTGGAGGAAAAAAGG + Intronic
1130941671 15:88515186-88515208 ATGAAATTATTGAGGAAACCAGG - Intronic
1131328033 15:91467961-91467983 ATGATATCAAAGAGGCAAACTGG - Intergenic
1131705414 15:94990321-94990343 ATGTTACCATTGGGGGAAACTGG + Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1131952568 15:97696595-97696617 ATGTTATCAGTGAGAGAAACTGG - Intergenic
1132077736 15:98836557-98836579 ATGCTAACGTTAGGGAAAACTGG - Intronic
1132296623 15:100739787-100739809 ATGTTACCATTGGAGAAAACAGG - Intergenic
1132411607 15:101582672-101582694 ATGCTACCACTGGGGGAAACTGG - Intergenic
1132420132 15:101658743-101658765 ATGTTACCATTGAGGAAAACTGG + Intronic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1135161003 16:20096362-20096384 ATGCAATCATTCAGGAATCCAGG + Intergenic
1137468446 16:48732666-48732688 ATGCCATCATTGGGAGAAACTGG - Intergenic
1138639465 16:58372006-58372028 ATGTTACCATTGGGGGAAACTGG - Intronic
1140069698 16:71638690-71638712 ATATTATCATTGGAGAAAACTGG - Intronic
1140426545 16:74866105-74866127 ATGTTACCATTGGGGGAAACTGG - Intergenic
1140729696 16:77844886-77844908 ATGCTATCATAGAGAATATCAGG + Intronic
1140869973 16:79097210-79097232 ATGCAATTATTGAGAAAAGCAGG - Intronic
1141092395 16:81139267-81139289 ATGTTAACATTGAGGAAATAGGG + Intergenic
1142739568 17:1923279-1923301 ATATTACCATTGAGGGAAACTGG + Intergenic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1144095369 17:11895551-11895573 ATGTTACCATTGTGGAAAACTGG - Intronic
1144424282 17:15126887-15126909 ATGTCACCATTGAGGAAATCTGG + Intergenic
1144437299 17:15253343-15253365 AAGATCTCAATGAGGAAAACAGG + Intronic
1144926800 17:18818243-18818265 CTGTTAACATTGAGTAAAACAGG - Intergenic
1146956573 17:36939549-36939571 ATCCAGTCCTTGAGGAAAACCGG - Intronic
1147187575 17:38720933-38720955 AAGCAATCAGTGAGCAAAACCGG + Intronic
1147908695 17:43841302-43841324 ATGCTAACATTAGAGAAAACAGG - Intergenic
1149186263 17:54001332-54001354 GTGCCCTCATTGGGGAAAACTGG - Intergenic
1149636215 17:58172046-58172068 ATGCCATCATAGAGGAAAATTGG + Intergenic
1150864811 17:68838616-68838638 ATGATAACACTAAGGAAAACAGG + Intergenic
1154092261 18:11376615-11376637 ATGCTGGAATTGAAGAAAACTGG - Intergenic
1154115728 18:11611677-11611699 ATGTTACCATTGATGAAAACTGG + Intergenic
1154120172 18:11645896-11645918 ATGTTACCATTGATGAAAACTGG + Intergenic
1155132580 18:22953206-22953228 CTGCTATAAATGAGGAAAGCAGG - Intronic
1156748128 18:40417293-40417315 ATGCTATAATTGAGGATGAAGGG + Intergenic
1157691933 18:49690758-49690780 ATGTTAACATTAAGGAAAGCTGG + Intergenic
1157994002 18:52533137-52533159 ATGATACCATTGGGGGAAACAGG - Intronic
1158433429 18:57414451-57414473 ATGTTTTCATTAAAGAAAACTGG + Intergenic
1158509993 18:58081870-58081892 ATGGTGTCATTGAGGTAAATAGG - Intronic
1159125810 18:64222884-64222906 ATGCTATCATTAATCAAAAAAGG - Intergenic
1159133080 18:64303467-64303489 ATATTATCAGTGAGGAAACCAGG + Intergenic
1159532561 18:69672780-69672802 ATGCTTTCATTCTTGAAAACTGG - Intronic
1160136951 18:76280441-76280463 ATGTTACCATTCAGGGAAACTGG - Intergenic
1161141113 19:2648435-2648457 ATGCTAACATAAGGGAAAACTGG + Intronic
1161387481 19:4003770-4003792 ATACTATCACTGGGGAAAGCTGG + Intergenic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1165637177 19:37350474-37350496 ATATTATCATTGGGGAAAGCAGG - Intronic
1165896900 19:39146983-39147005 GTGTTACCATTGGGGAAAACTGG - Intronic
1165915135 19:39253957-39253979 ATGTTACCATTGGGGGAAACTGG + Intergenic
1166616625 19:44254327-44254349 ATTCTATCATGGTGGAAAAGTGG + Intronic
1168212706 19:54902264-54902286 ATGCTAACTTTGGGGAAATCTGG + Intergenic
1168453627 19:56486594-56486616 ATGGTAGCATTAAGGAAAGCTGG - Intergenic
925475914 2:4214852-4214874 ATGCTAACATTGAGAATCACTGG - Intergenic
925770010 2:7273119-7273141 ATGTTAACAATGAGGGAAACAGG + Intergenic
927145052 2:20158812-20158834 ATGTTACCATTGGGGGAAACCGG - Intergenic
927690644 2:25205661-25205683 ATGTTACCATTGGGGAAAACTGG - Intergenic
928433287 2:31237704-31237726 ATGCTATAAGTAAGAAAAACTGG - Intronic
928549283 2:32356155-32356177 ATGCAACCATTGGGGGAAACTGG + Intergenic
928598516 2:32880553-32880575 TTCATATCTTTGAGGAAAACTGG - Intergenic
930291787 2:49503236-49503258 ATGTTATCATTGAGAGAAGCAGG - Intergenic
932315863 2:70781980-70782002 ATGCAACCATTGCGGAAAACTGG + Intronic
933194423 2:79372162-79372184 ATGCCATCAGTCAGGAAATCAGG - Intronic
933261001 2:80131367-80131389 ACATTATCATTGAGGAAAGCTGG + Intronic
933884678 2:86707121-86707143 ATGTTATCATTGGGGGAAACTGG - Intronic
934035568 2:88086175-88086197 ATGTTACCATTGGAGAAAACTGG + Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935266242 2:101397022-101397044 ATTCTCTCATTAAGGAAATCGGG + Intergenic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935555362 2:104503773-104503795 TTATTATCATTGAGTAAAACTGG - Intergenic
935634637 2:105240769-105240791 ATGTTACCATTAGGGAAAACTGG + Intergenic
936975487 2:118217070-118217092 ATATTACCATTGAGGGAAACTGG + Intergenic
937685486 2:124691713-124691735 ATGGTCTAATTGAAGAAAACTGG - Intronic
937816303 2:126254408-126254430 ATTCTACTATTGAGGAAAACTGG - Intergenic
938180974 2:129182054-129182076 ATGTTACCACTGAGGACAACTGG - Intergenic
939318922 2:140589985-140590007 ATGTAATCATTAGGGAAAACTGG + Intronic
939624446 2:144459873-144459895 ATTCTCTCATAGAGGAAAACAGG + Intronic
939842695 2:147207779-147207801 TTGCTATCACTGTGGAAGACAGG + Intergenic
941008136 2:160268651-160268673 ATGTTTTCATTGTTGAAAACTGG + Intronic
941036403 2:160573744-160573766 ATGTTACCATTGGGGAAAACTGG + Intergenic
942175135 2:173326044-173326066 ATGTTACCACTGGGGAAAACTGG - Intergenic
942284665 2:174403830-174403852 ATGTTACCATTGGGGGAAACTGG + Intronic
942497516 2:176555302-176555324 ATGTTACCATTGTGGGAAACTGG - Intergenic
943450952 2:188041325-188041347 ATGTTACTATTGGGGAAAACTGG + Intergenic
943600601 2:189916174-189916196 ATGTTACCATTGAGGAGAACTGG - Intronic
943644899 2:190399722-190399744 ATGCTAACACTGGGGAAAGCTGG + Intergenic
944476868 2:200115444-200115466 ATGGTATCACTTAGGAAAAGAGG - Intergenic
945326089 2:208484414-208484436 ATGCCACCATTGAGGGAAACTGG - Intronic
946890083 2:224266137-224266159 ATGCTAACATTGAGGAAAGTTGG + Intergenic
947366513 2:229401733-229401755 ATGTTATCATTGGAGGAAACTGG + Intronic
947550932 2:231046175-231046197 ATGTTACCATTGGGGGAAACTGG - Intronic
948224355 2:236297601-236297623 ATGTTACCATTGGGGGAAACTGG + Intergenic
1168817259 20:747488-747510 ATGCTATCATTGAGAGAAGTTGG - Intergenic
1169246461 20:4028937-4028959 ATGTTACCATTGGGGGAAACTGG - Intergenic
1169470001 20:5876973-5876995 ATGATATCATTGAAGGAAACTGG + Intergenic
1170197800 20:13707979-13708001 ATACTACCATTGAGGGAAACTGG - Intergenic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1173045857 20:39511100-39511122 ATGTTATCATTGGGGGAAACTGG - Intergenic
1173095334 20:40022476-40022498 ATGCTGCCACAGAGGAAAACTGG + Intergenic
1173186156 20:40842098-40842120 ATGTTAACTTTGAGGAAATCTGG + Intergenic
1173343133 20:42172614-42172636 GTGTTAACATTGGGGAAAACTGG - Intronic
1173754323 20:45501689-45501711 ATGATACCATGGAGGAAAAGAGG - Intergenic
1174609392 20:51786695-51786717 GTGCTACCAATGGGGAAAACTGG + Intronic
1174926084 20:54761556-54761578 ATACTACTATTGTGGAAAACTGG + Intergenic
1174976001 20:55335039-55335061 ATGCTATCATTTGGGGAAGCTGG - Intergenic
1174978869 20:55368975-55368997 GTTCTGTCATTTAGGAAAACAGG - Intergenic
1177299033 21:19216577-19216599 ATGCTTTCTTTGAGGAAATTGGG - Intergenic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1177800359 21:25822853-25822875 CTGTTTTCATTGATGAAAACTGG + Intergenic
1178816757 21:35937461-35937483 AGGTTAACATTAAGGAAAACAGG + Intronic
1179346028 21:40558139-40558161 TTTCTATCACTGAGAAAAACAGG + Intronic
1179534150 21:42040451-42040473 AAGCTACCATCGTGGAAAACAGG - Intergenic
1180164370 21:46014999-46015021 ATGCTAACGTTGGGGGAAACTGG - Intergenic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1181323632 22:22028127-22028149 ATGCCACTTTTGAGGAAAACTGG + Intergenic
1182912539 22:33997507-33997529 ATTCTATCATGACGGAAAACAGG - Intergenic
1183019493 22:35015859-35015881 ATGTTAACAATGGGGAAAACGGG + Intergenic
1184624330 22:45711600-45711622 ATGTTACCATTGGGGAAAACTGG + Intronic
1184701303 22:46175211-46175233 ATGTTACCCTTGGGGAAAACTGG - Intronic
1184985118 22:48126940-48126962 ATGTTAACAATAAGGAAAACTGG + Intergenic
949347691 3:3091847-3091869 ATGTTACCCTTGAGGAAAACTGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
950932608 3:16805519-16805541 ATGCCAGGATTGAGGAAATCTGG + Intronic
952208707 3:31206737-31206759 AAGTTATCACTGGGGAAAACTGG - Intergenic
952522708 3:34177971-34177993 ATACTCTCATTGAGAAAAGCTGG + Intergenic
952532548 3:34277158-34277180 ATGCAGTCATTCAGGAACACAGG + Intergenic
952750174 3:36818453-36818475 ATGCTCTCATGGAGTAAAATAGG + Intergenic
952831185 3:37566439-37566461 ATGTTATCATTGGGAAAAGCCGG - Intronic
953728547 3:45424009-45424031 ATGTTATCATTGGGCAAAGCTGG - Intronic
954965651 3:54608250-54608272 ATGTTATCATTGGGGGAAGCTGG + Intronic
955024151 3:55151148-55151170 ATGTTATCACTGGGGAAAACTGG - Intergenic
955151695 3:56374009-56374031 ATGATATTATAAAGGAAAACTGG - Intronic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
955633626 3:61001906-61001928 ATATTAACATTGGGGAAAACTGG + Intronic
955846271 3:63166422-63166444 ATGTTACCATTAGGGAAAACCGG - Intergenic
956594054 3:70947323-70947345 GTGCTATAATTGAAGAAAATGGG + Intergenic
958858487 3:99416588-99416610 ATGTTAACATTGGGGAAAACTGG + Intergenic
958958764 3:100489299-100489321 ATGTTACCATTGGGGGAAACTGG - Intergenic
960067946 3:113395214-113395236 ATGCTCACATTTAGTAAAACTGG + Intronic
960444436 3:117730394-117730416 ATACTATCATTGGGGAAAGTTGG - Intergenic
960517447 3:118617901-118617923 ATACTAACATTAGGGAAAACTGG - Intergenic
960651927 3:119960549-119960571 ATGTAATCATTGAGGGAAAGTGG + Intronic
962124528 3:132601857-132601879 ATGGAACCATTGGGGAAAACTGG + Exonic
962328779 3:134459051-134459073 ATGTTAACAGTGAGGAAATCTGG - Intergenic
963308676 3:143683410-143683432 ATGCTATTATTGAGAAAATTGGG - Intronic
963640049 3:147849781-147849803 ATGATGTCTTTGAAGAAAACTGG + Intergenic
963954754 3:151241719-151241741 ATGCTTTCTTTGTGGAATACTGG + Intronic
964171546 3:153775977-153775999 ATGTTACTATTGTGGAAAACTGG - Intergenic
964644583 3:158945060-158945082 ATCTTACCATTGAGGCAAACTGG - Intergenic
965295779 3:166943881-166943903 AGGCTATCATTCAAGAAAATTGG + Intergenic
965389066 3:168082230-168082252 ATGCTACCCTTAAGGAAGACAGG + Intronic
965915404 3:173840193-173840215 ATACTATCATTCAAGAAAAAGGG + Intronic
967919630 3:194604685-194604707 GTGCTATCATTTTGGAAATCGGG - Intronic
968788221 4:2640362-2640384 ATGCTTTCACTGAGAAAAAGGGG + Intronic
970750845 4:19358609-19358631 ATGTTACCATTGGGGGAAACTGG + Intergenic
970904072 4:21194774-21194796 ATGCTATCATTCAGGAACCTGGG - Intronic
970943126 4:21658775-21658797 ATGACATCATTGAGGATCACAGG + Intronic
970973959 4:22021496-22021518 AAGCTAACATTAAGGAAAAGGGG + Intergenic
971248410 4:24950933-24950955 ATGCTAGATTTGAGGAACACAGG - Intronic
972833191 4:42837387-42837409 ATGCCATCATTGAGGGAAGCTGG + Intergenic
973950514 4:56008490-56008512 ATGCTACCATTGACAAAAATGGG - Intronic
974330893 4:60477204-60477226 ATCCTATCAATGATGAAAAATGG - Intergenic
974750988 4:66140671-66140693 ATGATATCATTGAGGACAGGAGG + Intergenic
974941889 4:68479106-68479128 ATGTAATCATTGGAGAAAACTGG - Intronic
975223466 4:71841185-71841207 TTGCTAACATTGGAGAAAACTGG - Intergenic
975225699 4:71869351-71869373 ATGTTACCATTGGGAAAAACTGG - Intergenic
975875745 4:78834986-78835008 ATGCTAGAATTCAGGAAAATGGG - Intronic
976103591 4:81592491-81592513 ATGAGATAATTGAGGAAGACAGG - Intronic
976421195 4:84846272-84846294 ATGTCATCAATGAGGAAAAGTGG + Intronic
976616305 4:87081070-87081092 ATGCTAACATTTGGGAAATCTGG + Intronic
976627214 4:87198934-87198956 TTGTTATCATTGAGGGAAACTGG + Intronic
977421057 4:96800178-96800200 ATGTTATCATTGGAGGAAACTGG + Intergenic
977916923 4:102604385-102604407 ATGTTACCATTGGGGGAAACTGG - Intronic
977960822 4:103083328-103083350 TTGAGATCATTGAGGCAAACTGG - Intronic
977973472 4:103237684-103237706 ATGTTATCATTGGGAGAAACTGG + Intergenic
977986793 4:103391934-103391956 ATGTTATCATTGGGAGAAACTGG - Intergenic
978162015 4:105559940-105559962 ATTTTATCATTGAGAAAAATAGG + Intronic
978190505 4:105905479-105905501 ATGCCATCATTTATGAAAAAGGG - Intronic
978427816 4:108600693-108600715 GTTTTACCATTGAGGAAAACTGG - Intergenic
980625263 4:135366803-135366825 ATGTTACCATTAAGAAAAACTGG + Intergenic
981858805 4:149329222-149329244 ATGTTACCATTGTGAAAAACTGG - Intergenic
982212759 4:153052873-153052895 ATGTTAACATTTTGGAAAACTGG - Intergenic
982596907 4:157397003-157397025 CTATTATCATTGGGGAAAACTGG + Intergenic
983039255 4:162905836-162905858 ATGTTATGATTGAGGGTAACTGG + Intergenic
983584961 4:169344603-169344625 ATGTTACCATTGGGGAAAACTGG - Intergenic
983645193 4:169982531-169982553 ATGTTATCACTGAGAGAAACTGG + Intergenic
985177554 4:187217578-187217600 ATGTTACTATTGAGGAAAATTGG + Intergenic
985362923 4:189194406-189194428 AGGATATCACTGGGGAAAACCGG - Intergenic
985429754 4:189867852-189867874 ATGCTCTCATGGAGATAAACTGG + Intergenic
985841896 5:2312843-2312865 ATGTTACCAGTGAGGGAAACTGG - Intergenic
986004936 5:3659741-3659763 ATGTTATCATTGAGGGAAACTGG - Intergenic
986946852 5:13031569-13031591 ATGATATCATTGAGGGTAACGGG + Intergenic
987100721 5:14589230-14589252 GTGCTATGAGAGAGGAAAACAGG + Intronic
987497028 5:18659133-18659155 ATGTTATCATGCAGGGAAACTGG + Intergenic
988120795 5:26958568-26958590 ATGATATATTTGACGAAAACTGG + Intronic
988612758 5:32743277-32743299 ATGTTACCATTGCGGGAAACTGG - Intronic
988661296 5:33272146-33272168 ATGCTATCATTGGGGGAAGTTGG + Intergenic
992424279 5:76640134-76640156 ATGCATTCATTGAATAAAACAGG - Intronic
992981796 5:82182848-82182870 ATGTTACCATTGGGGGAAACTGG + Intronic
992989152 5:82266091-82266113 ATACTATCATTTGGGAAAGCTGG - Intronic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
993249485 5:85500090-85500112 ATGCTATTACTGGGGAAAATTGG + Intergenic
993473205 5:88332315-88332337 ATGCTACCACTGAGGGGAACTGG - Intergenic
993943049 5:94084748-94084770 ATCATATCACTGGGGAAAACAGG + Intronic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
995458487 5:112377330-112377352 AAGTTACCATTGAGGGAAACTGG + Intronic
995516732 5:112961776-112961798 ATGTTACCATTGCGGAAAACTGG + Intergenic
996326243 5:122277738-122277760 CTGCTATCATTGATGGAAGCTGG - Intergenic
996326389 5:122279371-122279393 AGGCTATCACTGAGGGAAGCTGG + Intergenic
996869493 5:128172279-128172301 ATGTTATCATTGGGGGAAACTGG - Intronic
997034558 5:130173376-130173398 ATGTTATCAGTGAGAGAAACTGG - Intronic
997244027 5:132330820-132330842 ACTGTATCATTGAGGAAAAGAGG - Intronic
997275861 5:132588551-132588573 ATGTTATCATTGGGAGAAACTGG + Intronic
997676762 5:135719058-135719080 ATGTTATCACTGAGGAAAACTGG + Intergenic
998050474 5:139028621-139028643 ATGTTAACATTGAGGGAAGCTGG - Intronic
998277509 5:140770746-140770768 ATGTTACCATTGTGGAAAAGTGG - Intergenic
999080713 5:148840902-148840924 ATGCTAACATTCAGGGAAACAGG + Intergenic
999583944 5:153069999-153070021 ATTTTATCACTGGGGAAAACTGG - Intergenic
999674440 5:153984772-153984794 CTGTTATCATTGGGGGAAACTGG - Intergenic
1000559821 5:162771860-162771882 ATGTTACCATTGAGAAAAACTGG - Intergenic
1000667183 5:164013129-164013151 TAACTATCATTCAGGAAAACGGG + Intergenic
1000992645 5:167926857-167926879 ATGCTAGCTTTGGGGGAAACTGG + Intronic
1002326305 5:178409569-178409591 ATGCAACTATTGAGGAACACTGG + Intronic
1003085169 6:3054663-3054685 ATGCCACCATTGGGGGAAACCGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003907000 6:10710736-10710758 ATGTTATCATTGGGAAAACCGGG - Intergenic
1004018706 6:11756488-11756510 ATGTTACCATTGGGGGAAACTGG + Intronic
1004333879 6:14746331-14746353 ATGTGATCATTGGGGGAAACTGG + Intergenic
1004907166 6:20247200-20247222 AGGTTATCATTGGGGGAAACTGG + Intergenic
1006074056 6:31518270-31518292 ATGTTAACATTAAGGAAAGCTGG + Intergenic
1006249480 6:32769254-32769276 ATGTTACAATTGGGGAAAACTGG + Intergenic
1006252686 6:32802394-32802416 ATGTTATCCTTGGGGGAAACTGG - Intergenic
1006612327 6:35301646-35301668 CTACTATCATGGAGGAACACTGG - Intronic
1006953526 6:37845515-37845537 ATGCTTCCTTTGAGGAAAAGGGG - Intronic
1006976322 6:38105688-38105710 ATGTTACCCTTGGGGAAAACTGG + Intronic
1008044357 6:46836512-46836534 ATGCTAACATTAGGGAAAGCTGG - Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008677977 6:53841933-53841955 ATGTTACCATTGGGAAAAACTGG - Intronic
1009168788 6:60373315-60373337 ATGTTTTCATTGGGGAGAACTGG - Intergenic
1009507302 6:64500873-64500895 ATGCAATCAATAATGAAAACAGG - Intronic
1011339301 6:86295203-86295225 ATGTAATCACTGAGGGAAACTGG - Intergenic
1011835810 6:91430435-91430457 ATGTTACCATTTAGGAAAACTGG + Intergenic
1012289114 6:97429350-97429372 ATGTTACCATTGAGGAAAACTGG - Intergenic
1013147742 6:107411355-107411377 ATGACATCATTTATGAAAACTGG + Intronic
1013518973 6:110915315-110915337 ATGTTAACATTGTGGGAAACTGG - Intergenic
1013958762 6:115872330-115872352 ATGCTTTGAGTGAGGAAAAATGG - Intergenic
1014716754 6:124874456-124874478 ATGTTACCATTGAGAGAAACTGG - Intergenic
1014776328 6:125514164-125514186 ATGTTATTATTGGGGGAAACTGG - Intergenic
1015564579 6:134555030-134555052 TTACTATTATTGAGGGAAACGGG + Intergenic
1015979437 6:138824206-138824228 ATGGAACCATTGGGGAAAACTGG + Intronic
1016469059 6:144355730-144355752 ATGTTAACAGTGGGGAAAACTGG - Intronic
1016469064 6:144355761-144355783 ATGTTAACAGTGGGGAAAACTGG - Intronic
1017145743 6:151233012-151233034 ATGTTACTATTGGGGAAAACTGG - Intergenic
1019495303 7:1335874-1335896 ATGTTACCATTGGGGAAAATCGG - Intergenic
1020442183 7:8229477-8229499 ATGGTATCAATGAGAAAACCTGG + Intronic
1020670160 7:11096924-11096946 ATACTATCAATGAAGTAAACAGG - Intronic
1021858576 7:24882490-24882512 ATGCAATCATTGGTGGAAACAGG + Intronic
1022039846 7:26570370-26570392 ATGCTATCATTTGGGGAAACAGG + Intergenic
1022115854 7:27259905-27259927 ATGCAAATATTGAGAAAAACAGG + Intergenic
1022259366 7:28689513-28689535 ATGTTACCATTGAGGGTAACTGG - Intronic
1022448224 7:30487808-30487830 ATGTTACCACTGAGGAAAATTGG - Intergenic
1022859519 7:34352801-34352823 ATATTGTCATTGAGGGAAACTGG + Intergenic
1023531852 7:41165475-41165497 AAGTTAACATTGAGAAAAACGGG - Intergenic
1023937854 7:44752037-44752059 ATGTTACCATTGGGGCAAACTGG - Intronic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024962075 7:54987312-54987334 ATGCTATCTTTGAAGGAAACTGG + Intergenic
1026397546 7:69971465-69971487 ATGTTACCATTGAGGAAACTAGG - Intronic
1026626991 7:72003356-72003378 TTGCTTTCATGGATGAAAACAGG + Intronic
1026989734 7:74577607-74577629 ATTATATCATGGAGGAGAACAGG - Intronic
1027478166 7:78659770-78659792 ATGTTATCTTTGTGGACAACTGG + Intronic
1027533554 7:79366648-79366670 ATGTTATTATTGAAGGAAACTGG + Intronic
1028552748 7:92088888-92088910 ATGGTATCATTGGGAAAAGCTGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1028676435 7:93468520-93468542 ATCCTATCTTTGGGGAGAACAGG - Intronic
1028704871 7:93829980-93830002 ATGTTACCACTGAGGAAGACTGG + Intronic
1029653704 7:101910997-101911019 TTGTAATCAGTGAGGAAAACAGG + Intronic
1030377689 7:108772542-108772564 ATGCTTTCTTGGAGGAAAAAAGG - Intergenic
1030576765 7:111297301-111297323 ATGTTATCACTGGAGAAAACTGG + Intronic
1030945912 7:115720058-115720080 AGGCTATTAATGAAGAAAACGGG + Intergenic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1032616511 7:133478177-133478199 ATGGAATCATTGCAGAAAACAGG + Intronic
1032680861 7:134181754-134181776 ATATCAACATTGAGGAAAACTGG - Intronic
1032737185 7:134703250-134703272 TTGTTATTATTGAGGAAGACAGG + Intergenic
1033709316 7:143924427-143924449 ATGTTACCATTGATGAAAATTGG + Intergenic
1035953400 8:4049774-4049796 ATGCTAACAGTAAGGAAAACGGG - Intronic
1038355416 8:26824617-26824639 ATGCTGGCATTGAGCAAAAAGGG - Intronic
1039201990 8:35105236-35105258 CTGTATTCATTGAGGAAAACAGG + Intergenic
1039859948 8:41448407-41448429 ATTCAATCAGTGAGGAGAACTGG - Intergenic
1040943623 8:52857977-52857999 ATGTTACCATTGAGTGAAACTGG - Intergenic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1041085997 8:54256896-54256918 ATGCTAACAATGAGGAAACTGGG - Intergenic
1041323451 8:56638370-56638392 ATACTATCATTAAGGCACACAGG - Intergenic
1041557881 8:59179281-59179303 ATGCTACCATTGGAGAAAACTGG - Intergenic
1042095768 8:65214220-65214242 ATGCTATTAATGAAGAAAATGGG + Intergenic
1042292197 8:67180684-67180706 ATGTTACCATTGGGGGAAACTGG + Intronic
1042355946 8:67827733-67827755 ATGGAATCATTGAGGAAGAGTGG + Intergenic
1042896526 8:73675978-73676000 ATGCTATCAATGGGGAATAAAGG + Intronic
1043504838 8:80892251-80892273 ATGTTACCGTTGGGGAAAACTGG + Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044274501 8:90284370-90284392 AAGTTATCATGGAGGCAAACAGG - Intergenic
1044980502 8:97711547-97711569 ATGTTACCACTGGGGAAAACTGG - Intronic
1045027477 8:98101702-98101724 ATCATATCATTGATGAAAAGGGG + Intergenic
1045074282 8:98545396-98545418 ATGCCATCATTGCTAAAAACAGG + Intronic
1045257102 8:100535406-100535428 ATGTTACCATTGGGGGAAACTGG - Intronic
1045466523 8:102475615-102475637 ATGTTACCATTGAGGGAAACTGG + Intergenic
1046513881 8:115233457-115233479 ATTCTATCATTTAGTAATACTGG + Intergenic
1047065449 8:121277095-121277117 ATGTTACCATTGGGGGAAACTGG - Intergenic
1047201147 8:122768906-122768928 ATGTTATCGTTTAGGAAAACTGG + Intergenic
1047450031 8:124956863-124956885 ATGATATTATTGAGGATAATAGG - Intergenic
1047862642 8:128985210-128985232 ATGCTATGCATTAGGAAAACAGG - Intergenic
1049522476 8:143100820-143100842 ATGTTACTATTGAGGGAAACTGG + Intergenic
1050522273 9:6513234-6513256 ATGCTATCCCTGAGGGAAACTGG - Intergenic
1051491279 9:17669178-17669200 ATGTTACCACTGGGGAAAACTGG - Intronic
1051519128 9:17964689-17964711 ATGTTACCATTAAGGTAAACTGG + Intergenic
1052058489 9:23930079-23930101 ATGCTAACATTCAGGGAATCGGG + Intergenic
1052450975 9:28630983-28631005 ATGTTACCATTGGAGAAAACTGG + Intronic
1053164386 9:35834370-35834392 ATGCTATTGGTGAGGAAGACTGG + Intronic
1055310586 9:74975502-74975524 ATGCTATCTTTGGGGGAAGCTGG + Intergenic
1055523810 9:77109816-77109838 ATGTTATCATTGGGTAAAATTGG + Intergenic
1055529810 9:77172658-77172680 ATGTCACCATTGGGGAAAACTGG - Intergenic
1056067478 9:82951935-82951957 ATGCTATAATTAAGGAAATGTGG - Intergenic
1056109227 9:83378069-83378091 ATGCTGTAAGTGAGGAAACCAGG - Intronic
1056175261 9:84028616-84028638 ATGCTATCATTTTGGAAAACTGG - Intergenic
1056275782 9:84992803-84992825 ATGTTACCATTGAGGGAAGCTGG + Intronic
1057073595 9:92121895-92121917 ATGTTAACACTGGGGAAAACTGG - Intergenic
1057094227 9:92290878-92290900 ATCTTCTCTTTGAGGAAAACTGG + Intronic
1057107674 9:92435424-92435446 ATGTTATCATTAGGGGAAACTGG - Intronic
1057425979 9:94950148-94950170 ATGCTGTCATGGGGGAAAGCTGG - Intronic
1058571339 9:106348621-106348643 ATGTTGACATTGGGGAAAACTGG + Intergenic
1059382771 9:113940759-113940781 ATGTTATCAATGACGAAAGCTGG - Intronic
1059526791 9:114999564-114999586 ATACTACCATTGGGGGAAACTGG - Intergenic
1059530730 9:115033078-115033100 ATTCTCCCATTGAAGAAAACAGG - Intronic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1059935946 9:119310760-119310782 ATGCTAGCATACAGGAAGACAGG + Intronic
1060037478 9:120268533-120268555 ATGCTGCCATTGGGGGAAACTGG + Intergenic
1060632545 9:125172907-125172929 ATGTTACCACTGGGGAAAACTGG + Intronic
1062296481 9:135831234-135831256 AAGCTACCATTGAGTAAAAAAGG + Intronic
1186676776 X:11825777-11825799 ATGTTCTCATTTAGGAAAGCTGG + Intergenic
1186754967 X:12661017-12661039 ATGCTCACTTTGAGGAAAGCCGG - Intronic
1186936390 X:14454326-14454348 ATGTTATTATGGAGTAAAACTGG + Intergenic
1187070683 X:15884818-15884840 ATCCTAGCAAAGAGGAAAACAGG + Intergenic
1187146295 X:16640320-16640342 ATGGTTTCATTTAGGAAAAGAGG - Intronic
1187316423 X:18199534-18199556 ATGTTATCATTGAGGAAAATGGG + Intronic
1187539427 X:20177232-20177254 ATGTTACCATTGGGGGAAACTGG - Intronic
1188063266 X:25626968-25626990 ATGGTAGCATTAGGGAAAACTGG - Intergenic
1188270590 X:28135199-28135221 GTGCTACCATTGTGGAGAACTGG - Intergenic
1188540211 X:31241544-31241566 GTGATACCATTGAGGAAAAGAGG - Intronic
1188570216 X:31576097-31576119 ATGCTATCATTGGGAGAAGCTGG - Intronic
1188666636 X:32830561-32830583 ATGTTTTCATTGTGCAAAACAGG - Intronic
1188707647 X:33355753-33355775 ATGTTATCATTGGGAGAAACTGG - Intergenic
1189826259 X:44921275-44921297 ATGCTAACATTGGGGAAAGTTGG - Intronic
1189866041 X:45328236-45328258 ATGTTACCACTGAGGGAAACTGG - Intergenic
1190444780 X:50513859-50513881 ATGTTATCCTTGTGGGAAACTGG + Intergenic
1190892340 X:54581145-54581167 ATGTTACCATTGGGGGAAACTGG - Intergenic
1190908705 X:54752540-54752562 ATGCTCTAATTGAAGAGAACTGG + Intronic
1192254776 X:69447148-69447170 ATGTTACCATTGGGGGAAACTGG - Intergenic
1192331759 X:70181129-70181151 GTGCAGCCATTGAGGAAAACAGG - Intronic
1192545659 X:72010782-72010804 AAGTGATTATTGAGGAAAACTGG - Intergenic
1192606401 X:72523613-72523635 ATGGGATCACTGAGGAAAAGTGG - Intronic
1194109266 X:89811957-89811979 ATGTTACAAATGAGGAAAACTGG - Intergenic
1194755899 X:97738938-97738960 ATTCTTTGATTGAGGAATACAGG - Intergenic
1195911446 X:109892014-109892036 ATGTTACCATTGGGGAAAACTGG - Intergenic
1195977467 X:110543132-110543154 ATGCTACCTTTGGGGAAAATTGG + Intergenic
1196003626 X:110812393-110812415 ATGTTAACATTAAGGGAAACTGG - Intergenic
1196289125 X:113917798-113917820 ATGTTACCATTGAGGAAAACTGG - Intergenic
1196755979 X:119157661-119157683 ATGTTACCATTGGGGGAAACTGG - Intergenic
1196999553 X:121423474-121423496 AAGCTATCATTAAGGAAGATGGG - Intergenic
1197001512 X:121445106-121445128 ATACTATCATTGAAGAATGCAGG - Intergenic
1197686835 X:129449085-129449107 ATGTTACTATTGGGGAAAACTGG + Intronic
1198406564 X:136318648-136318670 ATGCTATGAGTGAGAAAAGCAGG + Intronic
1198419719 X:136458601-136458623 ATGTCACCATTGGGGAAAACTGG - Intergenic
1198589986 X:138168025-138168047 ATGATAGCATTGGGGAAAACTGG - Intergenic
1198789177 X:140324171-140324193 ATGCTATCATTGGAAAAAACTGG + Intergenic
1199669941 X:150136659-150136681 ATGGTACCATTGAAGGAAACTGG + Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200428054 Y:3043834-3043856 AAGTTACCATTGAAGAAAACTGG - Intergenic
1200461929 Y:3466700-3466722 ATGTTACAAATGAGGAAAACTGG - Intergenic
1201551286 Y:15219431-15219453 ATGCTTTCAGTCAGGGAAACTGG + Intergenic
1201743850 Y:17350296-17350318 TTGCTTTCAATAAGGAAAACTGG + Intergenic