ID: 1044057423

View in Genome Browser
Species Human (GRCh38)
Location 8:87588462-87588484
Sequence GATCTATTAAGATCAACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044057420_1044057423 4 Left 1044057420 8:87588435-87588457 CCTCAGCCTTCTTTTGAAAAACT 0: 1
1: 0
2: 1
3: 33
4: 402
Right 1044057423 8:87588462-87588484 GATCTATTAAGATCAACACCAGG No data
1044057422_1044057423 -2 Left 1044057422 8:87588441-87588463 CCTTCTTTTGAAAAACTGGAAGA 0: 1
1: 1
2: 6
3: 46
4: 448
Right 1044057423 8:87588462-87588484 GATCTATTAAGATCAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044057423 Original CRISPR GATCTATTAAGATCAACACC AGG Intronic
No off target data available for this crispr