ID: 1044062420

View in Genome Browser
Species Human (GRCh38)
Location 8:87654377-87654399
Sequence AGATACAGAATATACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044062415_1044062420 18 Left 1044062415 8:87654336-87654358 CCTTTGCTACATGCAATGGAGAA No data
Right 1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044062420 Original CRISPR AGATACAGAATATACTGGGA AGG Intergenic
No off target data available for this crispr