ID: 1044079264

View in Genome Browser
Species Human (GRCh38)
Location 8:87863814-87863836
Sequence ACATAGAGTCAACACTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044079264_1044079271 29 Left 1044079264 8:87863814-87863836 CCATTCCAGTGTTGACTCTATGT No data
Right 1044079271 8:87863866-87863888 TATGCCTGGGCTCAGTAATATGG No data
1044079264_1044079267 1 Left 1044079264 8:87863814-87863836 CCATTCCAGTGTTGACTCTATGT No data
Right 1044079267 8:87863838-87863860 CTCATGTAACTATGATAGCAGGG No data
1044079264_1044079269 15 Left 1044079264 8:87863814-87863836 CCATTCCAGTGTTGACTCTATGT No data
Right 1044079269 8:87863852-87863874 ATAGCAGGGAAGGCTATGCCTGG No data
1044079264_1044079270 16 Left 1044079264 8:87863814-87863836 CCATTCCAGTGTTGACTCTATGT No data
Right 1044079270 8:87863853-87863875 TAGCAGGGAAGGCTATGCCTGGG No data
1044079264_1044079268 5 Left 1044079264 8:87863814-87863836 CCATTCCAGTGTTGACTCTATGT No data
Right 1044079268 8:87863842-87863864 TGTAACTATGATAGCAGGGAAGG No data
1044079264_1044079266 0 Left 1044079264 8:87863814-87863836 CCATTCCAGTGTTGACTCTATGT No data
Right 1044079266 8:87863837-87863859 GCTCATGTAACTATGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044079264 Original CRISPR ACATAGAGTCAACACTGGAA TGG (reversed) Intergenic
No off target data available for this crispr