ID: 1044080727 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:87879718-87879740 |
Sequence | ATGCTTTCTTTGGTGAAACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1044080723_1044080727 | 24 | Left | 1044080723 | 8:87879671-87879693 | CCAGATAATCTCTTTAGTAAATC | No data | ||
Right | 1044080727 | 8:87879718-87879740 | ATGCTTTCTTTGGTGAAACAGGG | No data | ||||
1044080724_1044080727 | -5 | Left | 1044080724 | 8:87879700-87879722 | CCTATTTGCTAAAATAACATGCT | No data | ||
Right | 1044080727 | 8:87879718-87879740 | ATGCTTTCTTTGGTGAAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1044080727 | Original CRISPR | ATGCTTTCTTTGGTGAAACA GGG | Intergenic | ||
No off target data available for this crispr |