ID: 1044080727

View in Genome Browser
Species Human (GRCh38)
Location 8:87879718-87879740
Sequence ATGCTTTCTTTGGTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044080723_1044080727 24 Left 1044080723 8:87879671-87879693 CCAGATAATCTCTTTAGTAAATC No data
Right 1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG No data
1044080724_1044080727 -5 Left 1044080724 8:87879700-87879722 CCTATTTGCTAAAATAACATGCT No data
Right 1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044080727 Original CRISPR ATGCTTTCTTTGGTGAAACA GGG Intergenic
No off target data available for this crispr