ID: 1044085281

View in Genome Browser
Species Human (GRCh38)
Location 8:87936072-87936094
Sequence CCATCGCATGCCCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044085281_1044085289 22 Left 1044085281 8:87936072-87936094 CCCCATCACAGGGCATGCGATGG No data
Right 1044085289 8:87936117-87936139 GCCCCACTGCTCAAATCTCTTGG No data
1044085281_1044085291 23 Left 1044085281 8:87936072-87936094 CCCCATCACAGGGCATGCGATGG No data
Right 1044085291 8:87936118-87936140 CCCCACTGCTCAAATCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044085281 Original CRISPR CCATCGCATGCCCTGTGATG GGG (reversed) Intergenic
No off target data available for this crispr