ID: 1044086204

View in Genome Browser
Species Human (GRCh38)
Location 8:87945125-87945147
Sequence CTGGAAACACAGAAGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044086200_1044086204 30 Left 1044086200 8:87945072-87945094 CCTTAGCTTTGCTGCACAATTAA No data
Right 1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG No data
1044086202_1044086204 -1 Left 1044086202 8:87945103-87945125 CCAAATAGAAATCTGAACTGCAC No data
Right 1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044086204 Original CRISPR CTGGAAACACAGAAGAAACT TGG Intergenic
No off target data available for this crispr