ID: 1044087876

View in Genome Browser
Species Human (GRCh38)
Location 8:87963515-87963537
Sequence ATGTGTAAGTATATATGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044087875_1044087876 15 Left 1044087875 8:87963477-87963499 CCACATATAATTTTATCTTTTTT No data
Right 1044087876 8:87963515-87963537 ATGTGTAAGTATATATGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044087876 Original CRISPR ATGTGTAAGTATATATGTCT AGG Intergenic
No off target data available for this crispr