ID: 1044089077

View in Genome Browser
Species Human (GRCh38)
Location 8:87977096-87977118
Sequence TTCCCATTACACTCTCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044089077_1044089079 3 Left 1044089077 8:87977096-87977118 CCTCTAAGAGAGTGTAATGGGAA No data
Right 1044089079 8:87977122-87977144 CTAACATAGACTTGGCAGTGAGG No data
1044089077_1044089080 4 Left 1044089077 8:87977096-87977118 CCTCTAAGAGAGTGTAATGGGAA No data
Right 1044089080 8:87977123-87977145 TAACATAGACTTGGCAGTGAGGG No data
1044089077_1044089078 -5 Left 1044089077 8:87977096-87977118 CCTCTAAGAGAGTGTAATGGGAA No data
Right 1044089078 8:87977114-87977136 GGGAAAAGCTAACATAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044089077 Original CRISPR TTCCCATTACACTCTCTTAG AGG (reversed) Intergenic
No off target data available for this crispr