ID: 1044089079

View in Genome Browser
Species Human (GRCh38)
Location 8:87977122-87977144
Sequence CTAACATAGACTTGGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044089077_1044089079 3 Left 1044089077 8:87977096-87977118 CCTCTAAGAGAGTGTAATGGGAA No data
Right 1044089079 8:87977122-87977144 CTAACATAGACTTGGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044089079 Original CRISPR CTAACATAGACTTGGCAGTG AGG Intergenic
No off target data available for this crispr