ID: 1044093635

View in Genome Browser
Species Human (GRCh38)
Location 8:88033996-88034018
Sequence GATGGGTATTGCCTGTTGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044093635_1044093639 4 Left 1044093635 8:88033996-88034018 CCTATCAACAGGCAATACCCATC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1044093639 8:88034023-88034045 TCAGCATTTCACTTTTCTCAGGG 0: 1
1: 0
2: 2
3: 34
4: 379
1044093635_1044093638 3 Left 1044093635 8:88033996-88034018 CCTATCAACAGGCAATACCCATC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1044093638 8:88034022-88034044 CTCAGCATTTCACTTTTCTCAGG 0: 1
1: 0
2: 5
3: 37
4: 295
1044093635_1044093640 5 Left 1044093635 8:88033996-88034018 CCTATCAACAGGCAATACCCATC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1044093640 8:88034024-88034046 CAGCATTTCACTTTTCTCAGGGG 0: 1
1: 0
2: 0
3: 30
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044093635 Original CRISPR GATGGGTATTGCCTGTTGAT AGG (reversed) Exonic
900801582 1:4740367-4740389 GATGGGGAGTGAGTGTTGATGGG + Intronic
901295563 1:8158487-8158509 GATGGGAGTTGTCTGTGGATGGG + Intergenic
905164483 1:36070166-36070188 GATGGTTATTCCCTGTTTCTTGG + Exonic
905744856 1:40406435-40406457 AATGGGTAGTGCCTGCTAATGGG + Intronic
906426949 1:45722973-45722995 GATGGGAAGTGACTGCTGATGGG + Intronic
907160335 1:52364803-52364825 GATGGGGATCACCTGTTAATGGG + Intronic
907615924 1:55926827-55926849 GATGGGAAGTGCATGCTGATTGG - Intergenic
910165476 1:84323380-84323402 GATGTATATTGCCTGTTAAATGG + Intronic
912461996 1:109840859-109840881 AATGGGTATTACCTGCTAATGGG + Intergenic
919049936 1:192500338-192500360 GATGAGTTTTGCCTGTTCTTGGG - Intergenic
921316652 1:213898021-213898043 GATGGGTTTGGCCTGTTGCCTGG - Intergenic
1063895633 10:10678647-10678669 GAAGGAGATTGACTGTTGATAGG + Intergenic
1069142150 10:64840050-64840072 GATGGGGAGTGCATGCTGATTGG - Intergenic
1069611219 10:69773928-69773950 GATGGGAATTCCCTGTTTTTAGG - Intergenic
1070784049 10:79152991-79153013 GATGGGTTCTGTCTGTTGATGGG + Intronic
1072424190 10:95315572-95315594 GATAGGAATTTCCTTTTGATGGG - Intronic
1074320262 10:112395225-112395247 TTTGTATATTGCCTGTTGATTGG - Intronic
1077519307 11:3022373-3022395 GATGGGGATTGCCGGTTGCTGGG - Intronic
1079646182 11:22866219-22866241 GATGGGGAGTGCCTGCTGATTGG - Intergenic
1083700518 11:64474727-64474749 GCTGGGTACAGCCTCTTGATGGG - Intergenic
1084783963 11:71430819-71430841 GATGGGGAGTGCATGCTGATTGG + Intronic
1087425631 11:97982210-97982232 AATGGGGAATGCTTGTTGATTGG - Intergenic
1090981339 11:131725098-131725120 GATGGGGGATGCCTGTTCATGGG + Intronic
1093209992 12:16296969-16296991 AATGGGTAGAGCCTGATGATTGG - Intergenic
1095598565 12:43988601-43988623 AATGGGAATTGCATGGTGATAGG + Intronic
1096943564 12:55377291-55377313 GATGGCTGTTGCCTCTTGGTGGG - Intergenic
1099456192 12:82865220-82865242 GATGGGTCTTGACTCTTTATCGG - Intronic
1100992725 12:100267525-100267547 GGTGGGTGTTGCCTGGTGACGGG + Exonic
1101048150 12:100832353-100832375 GATGGGTATTGGCAGGTGTTGGG + Intronic
1105465634 13:20637145-20637167 GATGGGAAGTGACTATTGATGGG + Intronic
1109685336 13:65812687-65812709 GATGGGGACTGCGTGCTGATTGG - Intergenic
1113133687 13:107065248-107065270 TTTGGGGATTGCCTGGTGATTGG - Intergenic
1116836619 14:49774654-49774676 TATTGGTATTGCCTCTTGAATGG - Exonic
1124096181 15:26650766-26650788 GATGGGAAGTGCATGCTGATTGG - Intronic
1124821723 15:33052904-33052926 AATGGGTAGTGCATGCTGATTGG - Intronic
1134158600 16:11865372-11865394 GATGTGTTCTGCATGTTGATGGG + Intergenic
1135105136 16:19642877-19642899 GAAAGGTAATGCCTGTGGATAGG - Intronic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1135926792 16:26701936-26701958 GATGGGGAGTGCATGCTGATTGG - Intergenic
1138152352 16:54670345-54670367 GATGGGGAGTGCATGCTGATTGG + Intergenic
1138429573 16:56960132-56960154 GATGGGGAATGACTGTTTATTGG + Intergenic
1138710944 16:58969861-58969883 GATGGGGAGTGCATGCTGATTGG + Intergenic
1138819199 16:60238302-60238324 GATGGGGAGTGCATGCTGATTGG + Intergenic
1144887886 17:18476436-18476458 GCTGGGTATTGCCTGTGCACAGG - Intergenic
1145102066 17:20085819-20085841 GATGGATATTCCCTGTTCAGTGG + Intronic
1149644251 17:58228203-58228225 GATGGGGAGTGCGTGCTGATTGG + Intronic
1151032546 17:70758142-70758164 GATGGGTTTTGCATGTTGTTGGG + Intergenic
1156096365 18:33537535-33537557 GATGCTTATACCCTGTTGATGGG + Intergenic
1156372111 18:36480768-36480790 GATTTGTATTGCATGTTCATTGG + Intronic
1159633215 18:70773875-70773897 TTTAGGTCTTGCCTGTTGATTGG + Intergenic
1165000547 19:32758291-32758313 AATGGGGAGTGCCTGCTGATTGG + Intronic
1167110802 19:47459924-47459946 GGTGGGGATTGTCTGTTGCTTGG - Intronic
1167297642 19:48661218-48661240 GATTGGTGTTGCCTGACGATAGG - Intergenic
927220773 2:20707068-20707090 GGTGGGTATGGCCTTTGGATTGG - Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929648955 2:43658607-43658629 AATGGGTATTGGCTGTTGGTAGG + Intronic
931397946 2:61904820-61904842 AATGGGTAGTGACTGTTTATAGG - Intronic
931503595 2:62898984-62899006 GATTGGTCTTGCCTGTTTAAGGG + Intronic
933026854 2:77270935-77270957 AATGGGGATTGCATGCTGATTGG - Intronic
935496019 2:103782679-103782701 CCTGGGTATTGCCTGTGGAATGG - Intergenic
935789463 2:106577678-106577700 GATGGGTGAAGCCTGATGATGGG + Intergenic
938898357 2:135775636-135775658 GATGGGGAGTGACTGCTGATGGG + Intronic
939125262 2:138170684-138170706 GATGCGTATACACTGTTGATGGG + Intergenic
944344793 2:198649253-198649275 GAAGGGAATTGACTGTAGATGGG + Intergenic
945178867 2:207071125-207071147 TCTGGGCATTGACTGTTGATTGG + Intergenic
948198359 2:236111907-236111929 GTTGGTTGTTGCCTTTTGATTGG + Intronic
1170749640 20:19134088-19134110 GATGGATGTTGCCTGTTGAATGG - Intergenic
1177854400 21:26384918-26384940 GAAGGGTATGGCCTGTTACTTGG + Intergenic
1179575812 21:42307756-42307778 GATGGGGAGTGGCTGTTCATGGG - Intergenic
1181840922 22:25659865-25659887 GATGGGATTTGACTGTTCATGGG + Intronic
1183377649 22:37474375-37474397 CTTGGGTATTCCCTATTGATGGG - Intronic
953776514 3:45822156-45822178 GATGGGGAGTGACTGTTAATGGG - Intergenic
954125940 3:48528902-48528924 AATGGGAAGTGACTGTTGATGGG + Intronic
954971614 3:54656211-54656233 AATGTGTATGGCCTGATGATTGG + Intronic
955922649 3:63973827-63973849 AATGGGGAGTGCCTGCTGATTGG + Intronic
957546995 3:81651944-81651966 GATGGGTGTTGAATGTTGAAAGG + Intronic
958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG + Intergenic
959693554 3:109224851-109224873 GATGGGAAGTGCATGCTGATTGG + Intergenic
959928962 3:111957767-111957789 GATGGTTATTTCCTGTGGCTAGG + Intronic
961056376 3:123792424-123792446 GATGGGGAGTGGCTGCTGATAGG - Intronic
961824802 3:129593363-129593385 GATGGGCATTGGCTGCTGAAGGG - Intronic
966018659 3:175177917-175177939 CATGGGTATTGTCTATTAATAGG + Intronic
966987700 3:185197135-185197157 GATGGAGAGTGACTGTTGATGGG + Intronic
967374879 3:188789771-188789793 TCTGTGAATTGCCTGTTGATAGG - Intronic
971001865 4:22332595-22332617 AATGGGGAGTGCCTGCTGATTGG - Intergenic
971801506 4:31298786-31298808 GGTGGGTATCTGCTGTTGATGGG + Intergenic
971994899 4:33953491-33953513 GATGCTTATGCCCTGTTGATGGG - Intergenic
972861967 4:43180227-43180249 AATGGGGATAGCCTGTTGCTGGG + Intergenic
974170094 4:58255275-58255297 AATTGGTATTGCCAGTTTATTGG - Intergenic
974967753 4:68783795-68783817 AATGTGAATTCCCTGTTGATAGG + Intergenic
986576745 5:9220903-9220925 GATGAGAATTGCCTGAAGATGGG + Intronic
992902847 5:81316271-81316293 TAAGGGTATTGGCTGTTGATGGG - Intergenic
992907285 5:81358877-81358899 AATGGGTATTGCCCTTTGAAAGG + Intronic
993378296 5:87176155-87176177 GATGGGGAGTGCATGCTGATTGG - Intergenic
994434003 5:99705906-99705928 GATGGGGAATGTGTGTTGATTGG - Intergenic
996959453 5:129229070-129229092 AATGTGTATTCCCTGTTGTTTGG + Intergenic
997256847 5:132435600-132435622 GGTGGGTATTTACTGTTGTTGGG + Intronic
997603649 5:135157190-135157212 GGTGGGTATTGGCTCCTGATGGG + Intronic
998403722 5:141862115-141862137 GCTGGGTGTTGCCTGTTGTTGGG + Intronic
1001320694 5:170678631-170678653 GCTCAGTATTACCTGTTGATGGG + Intronic
1002852580 6:1009851-1009873 GATGGGGAGCGCCTGTTCATGGG + Intergenic
1003054592 6:2806706-2806728 GCTGGGTGTTTCCTGCTGATTGG - Intergenic
1003952822 6:11132777-11132799 GATGGGGAGTGACTGTTAATGGG + Intronic
1004885120 6:20043816-20043838 GATGGTTATACACTGTTGATGGG - Intergenic
1005026412 6:21466802-21466824 GATGGAGAGTGCTTGTTGATTGG - Intergenic
1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG + Intronic
1009537610 6:64908751-64908773 GATGGGGAGTGCTTGCTGATTGG + Intronic
1013464947 6:110409873-110409895 GATGGGAATTGTCTGTTCTTTGG - Intronic
1013586144 6:111580938-111580960 GGAGGGTATTGCCAGTTGGTTGG - Intronic
1018287934 6:162260970-162260992 GAAACGTATTGCCTGTTGATGGG + Intronic
1019048182 6:169163651-169163673 GATGGGAACTGCCTGCTGAGGGG + Intergenic
1019057921 6:169236293-169236315 GATGGGGAGTGACTGTGGATGGG - Intronic
1021386404 7:20035900-20035922 GATGGGGAGTGCGTGCTGATTGG + Intergenic
1026569187 7:71514531-71514553 GATGGGTATTGGATGAGGATGGG - Intronic
1029767473 7:102634343-102634365 CATGGCTACTGCCTGCTGATCGG + Intronic
1030029396 7:105354874-105354896 TATGGGGCGTGCCTGTTGATGGG - Intronic
1036598947 8:10241085-10241107 GATGGGACTTACCTTTTGATGGG + Intronic
1038429146 8:27485800-27485822 GATGGGGAGTGCATGCTGATTGG + Intergenic
1038562979 8:28596530-28596552 GATGGGGAATGCCTGCTGATTGG + Intergenic
1039494947 8:37973642-37973664 AATGGGGATTGCGTGCTGATTGG + Intergenic
1044093635 8:88033996-88034018 GATGGGTATTGCCTGTTGATAGG - Exonic
1045492026 8:102677229-102677251 GATGGGTATTTCATGTACATTGG - Intergenic
1046406225 8:113776053-113776075 AATGGGTAGTGCATGCTGATTGG - Intergenic
1048331030 8:133470951-133470973 GACGGGTGTGGCCTGTGGATAGG - Intronic
1049461980 8:142734517-142734539 GTTGGGTCTTGCATGTTGAGAGG + Intronic
1050910492 9:11063407-11063429 CCTGGCTATTGCCTGTTGTTTGG - Intergenic
1051406554 9:16743734-16743756 GATGGGTATAGGGTGTTGAGAGG + Intronic
1053119265 9:35533604-35533626 GATGGGGAGTGCCTGCTAATGGG - Intronic
1058588286 9:106533246-106533268 GATGGGGAGTGCATGCTGATTGG + Intergenic
1185695493 X:2191229-2191251 GATTGGGGTTGCCTGTGGATGGG + Intergenic
1188286414 X:28330700-28330722 AATGGGGATTGACTGTAGATGGG - Intergenic
1193665008 X:84305470-84305492 GATGGGTATTGCAGGTTGGCAGG + Intergenic