ID: 1044099462

View in Genome Browser
Species Human (GRCh38)
Location 8:88115273-88115295
Sequence ACTCATATTGTTACTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044099462 Original CRISPR ACTCATATTGTTACTCATTG TGG (reversed) Intronic
902031339 1:13424793-13424815 ACTCATCCTGTTACACATTCTGG - Intergenic
906762637 1:48389921-48389943 TCTCTTATTGTTTGTCATTGTGG - Intronic
908503298 1:64767239-64767261 ACTCATATGATTACTTATTAGGG + Intronic
909522553 1:76586508-76586530 ACTCCTATTATCACTCATTCTGG + Intronic
916154171 1:161828033-161828055 CCTCTTCTTATTACTCATTGGGG + Intronic
916178534 1:162063778-162063800 ACTAATATTGTCACTCAATGGGG + Intergenic
917309506 1:173664076-173664098 ACTCATGTTTTTACACACTGTGG - Intronic
917863270 1:179169228-179169250 ACTGTTATTGTTTCTCATAGTGG - Intronic
918763962 1:188454863-188454885 ATTTATATTCTTACTCATTTTGG + Intergenic
918869034 1:189942688-189942710 AGTTATATGGTTACTAATTGAGG + Intergenic
919263343 1:195227774-195227796 ATTCAGAATGTTACTGATTGGGG + Intergenic
919272358 1:195364291-195364313 ACTCATATTTTTATTTTTTGTGG - Intergenic
919344918 1:196363021-196363043 CCTAATATTAGTACTCATTGAGG + Intronic
919485421 1:198140401-198140423 TCTCATTTTGTTTCTAATTGAGG + Intergenic
924068504 1:240252258-240252280 TCTCTTATTGTTCATCATTGTGG + Intronic
1065663540 10:28033382-28033404 ACTCATATTTTTGCTTACTGTGG + Intergenic
1066260035 10:33720496-33720518 AATCATCTTGTTACCCATAGAGG - Intergenic
1068682951 10:59839720-59839742 AATGAACTTGTTACTCATTGTGG + Intronic
1069356082 10:67586876-67586898 TCTCTTATTGTTTATCATTGTGG + Intronic
1070291441 10:75117935-75117957 TGTCAGATTCTTACTCATTGAGG + Intronic
1070294751 10:75151180-75151202 AATTATATTGTTTCTTATTGTGG + Intronic
1070446499 10:76509819-76509841 ACACATATTTTCACTCATTGTGG - Intronic
1071399441 10:85255320-85255342 TCTCATATTCTTACTGATAGTGG - Intergenic
1073660029 10:105464680-105464702 AATCATTTTGTTACTCATACGGG + Intergenic
1074616076 10:115069451-115069473 ACTCATGCTGTTTTTCATTGGGG + Intergenic
1076924208 10:133473663-133473685 ACAAATATGGTTACTTATTGTGG + Intergenic
1078077456 11:8174775-8174797 ACTCATAATGTTAAACATTCTGG - Intergenic
1079844978 11:25453989-25454011 ACTCCTTTTGTCACTCGTTGCGG + Intergenic
1081520559 11:43877323-43877345 ACTCAAATGGTTACACACTGGGG - Intergenic
1081780929 11:45712053-45712075 ACTCATACTGTTACTAGATGAGG - Intergenic
1082757841 11:57095711-57095733 CTTCAAATTTTTACTCATTGTGG + Intergenic
1092954849 12:13540498-13540520 ATTTATCTTGTTTCTCATTGGGG - Exonic
1093393157 12:18648473-18648495 ACTCATAATCTTACTTATTGAGG + Intergenic
1094347730 12:29489273-29489295 TCACATATTGTTAAGCATTGTGG - Intronic
1098589314 12:72190947-72190969 ACTGAAATAGTTACTCATTCTGG + Intronic
1101337502 12:103809439-103809461 ACTCATATAGTCACTCACTGTGG - Intronic
1101688165 12:107046447-107046469 TCTCTTATTGTTTATCATTGTGG - Intronic
1102239578 12:111315879-111315901 ACTCATGTTGATACTAAATGGGG + Intronic
1108635167 13:52326697-52326719 TCTCTTATTGTTGATCATTGTGG - Intergenic
1108652640 13:52496532-52496554 TCTCTTATTGTTGATCATTGTGG + Intergenic
1109287805 13:60432382-60432404 ACTAATCTTGTTATTCATTATGG + Intronic
1109299053 13:60571745-60571767 ACACATATACTTCCTCATTGTGG + Intronic
1109838944 13:67897797-67897819 ACTCCTTTTGTTACTAATTTTGG - Intergenic
1110331713 13:74280494-74280516 ACACAGATTGTTTCTCATGGTGG + Intergenic
1120286974 14:82515372-82515394 AATAATATTGTTACCCATAGAGG - Intergenic
1123100431 14:105794062-105794084 TCTCTTATTGTTTATCATTGTGG - Intergenic
1125122844 15:36183232-36183254 CCAGATATTTTTACTCATTGAGG - Intergenic
1126480432 15:49112642-49112664 ACTCTTCTTGTTTGTCATTGTGG - Intronic
1127410358 15:58699429-58699451 TCTCTTATTGTTTATCATTGTGG - Intronic
1130692938 15:86101967-86101989 TCTCACATTGTTAATCATTGTGG + Intergenic
1132039126 15:98510317-98510339 ACTCATATCATTAGTCATCGGGG + Intronic
1137765271 16:50973192-50973214 ACTCTTGTTCTTACTCATTCTGG - Intergenic
1138841811 16:60518093-60518115 TCTCTTATTGTTTATCATTGTGG - Intergenic
1149501859 17:57158887-57158909 ACTCATATTGTTACTCAAACAGG + Intergenic
1150261294 17:63793936-63793958 AATCATATTGGTACTTAATGTGG + Intronic
1151073967 17:71249614-71249636 ATTGATATTGTCAGTCATTGGGG - Intergenic
1152060751 17:78073056-78073078 ATTCATATTGTTACTCTTCAAGG - Exonic
1157686631 18:49647934-49647956 ACTCAGATTGTGAGTCATGGAGG - Intergenic
1158953740 18:62521831-62521853 AATCACATTGTAACTCTTTGCGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
926768007 2:16339699-16339721 TCTCATATTGTTTATCATTGTGG - Intergenic
928757091 2:34540161-34540183 TCTCTTATTGTTTATCATTGTGG + Intergenic
929734617 2:44533791-44533813 TCTCTTATTGTTTATCATTGTGG - Intronic
933341608 2:81033410-81033432 ACTGATAGTGTTACCCATGGTGG - Intergenic
933512112 2:83253885-83253907 ACTCAGATTGTTTTTCAATGTGG + Intergenic
936830218 2:116635444-116635466 TCTCTTATTGTTTATCATTGTGG - Intergenic
937465472 2:122129316-122129338 TCTCATATTGTTTCTCAGTGTGG + Intergenic
937666362 2:124491850-124491872 ATTCATATTGTTAATCGTTTAGG - Intronic
940997574 2:160166417-160166439 AATCATATTATTAATCACTGTGG - Intronic
941983385 2:171485303-171485325 ACTCAGATTGTTTCTACTTGTGG + Intergenic
942915985 2:181307724-181307746 TCTCATATTGTTACTCAGGCTGG + Intergenic
943443977 2:187959889-187959911 ACTCCTAATGTTAGTCAGTGAGG - Intergenic
946966755 2:225043950-225043972 TTTCATATTGGTACTCAGTGTGG + Intergenic
948652338 2:239456133-239456155 TCTCATGTTTTCACTCATTGGGG + Intergenic
1177270781 21:18847400-18847422 AATCATATTCTTAGTCATTTAGG - Intergenic
1178199142 21:30383030-30383052 AGTCATATGGAAACTCATTGTGG - Intronic
1183045397 22:35215467-35215489 ACTCATTTATTTACACATTGTGG + Intergenic
952539263 3:34350241-34350263 ACTTATATTATTAGTCATTTGGG + Intergenic
952732741 3:36656253-36656275 TCTCATTTTGTTTCTAATTGAGG - Intergenic
954448849 3:50560997-50561019 ACTCATCTTGTTCCTCCGTGGGG + Exonic
956760662 3:72440998-72441020 ACTAGTATTGTTAGTCATTAGGG - Intronic
957852390 3:85825609-85825631 AATAATTTTGTTACTCATAGTGG - Intronic
960537679 3:118831218-118831240 ACTGATATAGTTACTAAGTGAGG + Intergenic
962824918 3:139092042-139092064 ATTCTTATTGTTACTCTCTGTGG - Intronic
967491387 3:190095510-190095532 TCTCTTATTGTTGCTCACTGTGG - Intronic
967576757 3:191103884-191103906 ACCCATAATGTCACCCATTGTGG + Intergenic
971061390 4:22975667-22975689 TCTCTTATTGTTTGTCATTGTGG + Intergenic
971066731 4:23041218-23041240 ACACTTATTGATACTTATTGTGG - Intergenic
971703531 4:30011028-30011050 TCTCTTATTGTTTATCATTGTGG + Intergenic
972481593 4:39502230-39502252 AGTCATGTTGTTACTCACTAGGG + Intronic
972550686 4:40130404-40130426 AGTCATATTGTTACCTCTTGTGG + Intronic
973088702 4:46103493-46103515 ATTCATATTGTTACCATTTGAGG + Intronic
974083760 4:57238217-57238239 GCTCATAGTGTTTCTCCTTGAGG - Intergenic
974243024 4:59276091-59276113 TCTCATATTCTTTATCATTGTGG - Intergenic
976127340 4:81848123-81848145 ATTCATTTGCTTACTCATTGTGG - Intronic
980589237 4:134862969-134862991 CCTCATTTTGATACTCGTTGAGG - Intergenic
982183236 4:152768888-152768910 ACTCATATTTTTAATCATTTTGG + Intronic
987439172 5:17934514-17934536 TCTCTTATTGTTTATCATTGTGG - Intergenic
988183067 5:27823396-27823418 ACTCATTTTGTTACACAAAGTGG + Intergenic
988803322 5:34717162-34717184 ACTTATACTGTGACTAATTGTGG + Intronic
989663836 5:43828437-43828459 TCTCTTATTGTTTGTCATTGTGG + Intergenic
990597818 5:57329048-57329070 ACACATATTGCTAATCTTTGTGG + Intergenic
992271537 5:75069342-75069364 ACTCATATTGTTGCTATCTGTGG - Intronic
993187793 5:84642525-84642547 TTTCATATTGTTATTCATAGTGG + Intergenic
994011441 5:94907658-94907680 ACTCATAATGTTATTAAGTGAGG + Intronic
994053241 5:95386005-95386027 AGTCAAATTGTTCCTCTTTGAGG + Intergenic
994545329 5:101159599-101159621 ACTAATTTTGTTACTCTTTGAGG + Intergenic
995961997 5:117853144-117853166 ACTGAAGTTGTTACTAATTGGGG + Intergenic
996477685 5:123939549-123939571 ATTCATATTATTACACATTTAGG - Intergenic
997664471 5:135618500-135618522 TCTCTTATTGTTTATCATTGTGG + Intergenic
999100614 5:149022327-149022349 AGTGATATTGTATCTCATTGTGG - Intronic
999466218 5:151808371-151808393 AATCATCTTTTTACTCATTTAGG - Exonic
1000516792 5:162246769-162246791 ACTCAAATTATTAGTCATTAGGG + Intergenic
1003740079 6:8926494-8926516 ACTGATTTTGTCCCTCATTGGGG + Intergenic
1005811441 6:29519181-29519203 ACTCAAATCTTTACTCACTGTGG - Intergenic
1008343869 6:50402484-50402506 AGGCATGTTGTTACACATTGAGG - Intergenic
1009623139 6:66101303-66101325 ACTCACATTGTTGTTCATAGAGG + Intergenic
1010509116 6:76695858-76695880 ACACATTATATTACTCATTGTGG + Intergenic
1011252250 6:85384292-85384314 ACACATATTGTTCCACATTAAGG + Intergenic
1012214790 6:96569980-96570002 TCTCTTATAGTTAATCATTGTGG + Intronic
1012397227 6:98812422-98812444 ACACATAATGTGAATCATTGTGG + Intergenic
1012591500 6:100986934-100986956 ACTTACATTGCTCCTCATTGAGG - Intergenic
1012600412 6:101090303-101090325 TCTCTTATTGTTTGTCATTGTGG + Intergenic
1012654213 6:101794519-101794541 TCTCTTATTGTTTATCATTGCGG + Intronic
1014060077 6:117061807-117061829 TCTCTTATTGTTTATCATTGTGG + Intergenic
1014343002 6:120231940-120231962 TCTCATATTGTTTATCATTGTGG - Intergenic
1017384186 6:153863412-153863434 TCTCTTATTGTTTATCATTGTGG - Intergenic
1017612992 6:156211639-156211661 ACTCTTATGGTTTATCATTGTGG + Intergenic
1018598543 6:165512104-165512126 TCTCTTATTGTTTGTCATTGTGG + Intronic
1022985900 7:35652986-35653008 TCTCATGTTGTTTTTCATTGTGG - Intronic
1023785209 7:43700427-43700449 ACCCATATTCTGACTCATTCCGG + Intronic
1024447819 7:49502053-49502075 TCTCATCTTCTGACTCATTGTGG + Intergenic
1028512557 7:91641173-91641195 ACTCAAATTGTTTCTCCTTTAGG - Intergenic
1028626463 7:92882668-92882690 TCTCTTATTGTTCATCATTGTGG - Intergenic
1029795039 7:102885356-102885378 ACTCATATCATTATTCATTAAGG - Intronic
1030126731 7:106160311-106160333 ACTCAAATGGTCCCTCATTGCGG - Intergenic
1031311276 7:120200665-120200687 TCTGAAATTGTTACTCATTTGGG + Intergenic
1032334618 7:131013435-131013457 AGTCAAATTGTGACGCATTGTGG - Intergenic
1034058343 7:148060545-148060567 ACTCATATTGTTTCTCCTTTAGG + Intronic
1034334830 7:150314556-150314578 AAACATATAGTTACTCTTTGAGG + Intronic
1037236837 8:16730394-16730416 ACTAGTATTGACACTCATTGAGG + Intergenic
1039208258 8:35181823-35181845 CCTCATATTGTTTTTCATGGAGG - Intergenic
1039308503 8:36290752-36290774 ACTCACTGTGTCACTCATTGTGG - Intergenic
1040063494 8:43124969-43124991 ACTCATATGTTTACTCATAAGGG + Intergenic
1040567482 8:48580940-48580962 ACTCATTTTGTTGCTCTTTAAGG + Intergenic
1041116290 8:54540611-54540633 ACTCATATTGTTACAGAGTAGGG + Intergenic
1042394247 8:68273096-68273118 ACTCAGATTGTTGCTGATAGTGG + Intergenic
1044099462 8:88115273-88115295 ACTCATATTGTTACTCATTGTGG - Intronic
1044166256 8:88987787-88987809 ACACATTTTGTTAGTCATTGGGG - Intergenic
1046279093 8:112001394-112001416 ACCCATTTTGGTAATCATTGTGG + Intergenic
1050379950 9:5018183-5018205 TCTCATATTGTTTAGCATTGTGG + Intronic
1050980072 9:11998851-11998873 ACTCTTTTTGTTCATCATTGTGG - Intergenic
1052686189 9:31759874-31759896 AGTCAAATTGTTCCTCTTTGTGG - Intergenic
1052695033 9:31867474-31867496 TCTCTTATTGTTTATCATTGTGG + Intergenic
1055300892 9:74880828-74880850 TCTCTTATTGTTTATCATTGTGG - Intronic
1055979319 9:81986490-81986512 ATACATATATTTACTCATTGTGG - Intergenic
1056433516 9:86552445-86552467 ACTCATATTCATATCCATTGAGG - Intergenic
1058963518 9:110015263-110015285 CCTCATATTGAGACTCATTTGGG - Intronic
1187534964 X:20133143-20133165 AGTCAAAATGTTACTCATTTTGG + Intronic
1188064076 X:25635532-25635554 TCTCTTATTGTTTATCATTGTGG - Intergenic
1189116748 X:38350815-38350837 ACTCATATTGGTAATGCTTGGGG - Intronic
1190092410 X:47451082-47451104 ATTCATATTGATACTCAGTTTGG + Intronic
1193783099 X:85727493-85727515 CCTCTTATTGTTTATCATTGTGG + Intergenic
1193903937 X:87219928-87219950 AATCATTTTGTTACTTTTTGAGG + Intergenic
1197048185 X:122025951-122025973 ACTCATTTTCCTTCTCATTGTGG + Intergenic
1197060056 X:122167608-122167630 ATTCATATGTTTACTCATTTTGG - Intergenic
1197295522 X:124714393-124714415 ACTCATAATATTAATCATTGAGG + Intronic
1197643320 X:128990941-128990963 TCTCTTATTGTTTATCATTGTGG + Intergenic
1197815579 X:130494707-130494729 ACTCATTTTCTTTCTCTTTGAGG + Intergenic
1200345616 X:155444161-155444183 TCTCTTATTGTTTATCATTGTGG - Intergenic
1201328665 Y:12795430-12795452 ACTTATCTTGTTCCTGATTGAGG + Intronic