ID: 1044110445

View in Genome Browser
Species Human (GRCh38)
Location 8:88266519-88266541
Sequence TGGATGAGGTGCCAGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044110445_1044110447 -10 Left 1044110445 8:88266519-88266541 CCAGGTCTCTGGCACCTCATCCA No data
Right 1044110447 8:88266532-88266554 ACCTCATCCAGGAATCTTTATGG No data
1044110445_1044110450 12 Left 1044110445 8:88266519-88266541 CCAGGTCTCTGGCACCTCATCCA No data
Right 1044110450 8:88266554-88266576 GCATTGTACTTCCACCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044110445 Original CRISPR TGGATGAGGTGCCAGAGACC TGG (reversed) Intronic