ID: 1044110447

View in Genome Browser
Species Human (GRCh38)
Location 8:88266532-88266554
Sequence ACCTCATCCAGGAATCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044110445_1044110447 -10 Left 1044110445 8:88266519-88266541 CCAGGTCTCTGGCACCTCATCCA No data
Right 1044110447 8:88266532-88266554 ACCTCATCCAGGAATCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044110447 Original CRISPR ACCTCATCCAGGAATCTTTA TGG Intronic