ID: 1044110461

View in Genome Browser
Species Human (GRCh38)
Location 8:88266597-88266619
Sequence CCCTCCTACTTTGGTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044110455_1044110461 -7 Left 1044110455 8:88266581-88266603 CCCATTTTCCTGAGTTCCCTCCT 0: 1
1: 0
2: 5
3: 38
4: 377
Right 1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG No data
1044110452_1044110461 6 Left 1044110452 8:88266568-88266590 CCCATTTGGCGTCCCCATTTTCC 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG No data
1044110456_1044110461 -8 Left 1044110456 8:88266582-88266604 CCATTTTCCTGAGTTCCCTCCTA 0: 1
1: 0
2: 4
3: 34
4: 716
Right 1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG No data
1044110453_1044110461 5 Left 1044110453 8:88266569-88266591 CCATTTGGCGTCCCCATTTTCCT 0: 1
1: 0
2: 0
3: 8
4: 215
Right 1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG No data
1044110454_1044110461 -6 Left 1044110454 8:88266580-88266602 CCCCATTTTCCTGAGTTCCCTCC 0: 1
1: 0
2: 2
3: 37
4: 414
Right 1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG No data
1044110451_1044110461 9 Left 1044110451 8:88266565-88266587 CCACCCATTTGGCGTCCCCATTT 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044110461 Original CRISPR CCCTCCTACTTTGGTAAAAT GGG Intronic
No off target data available for this crispr