ID: 1044110710

View in Genome Browser
Species Human (GRCh38)
Location 8:88269405-88269427
Sequence AGCCATAACAAAAGTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044110707_1044110710 -3 Left 1044110707 8:88269385-88269407 CCAAGATAATATCTTCACAGAGC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1044110710 8:88269405-88269427 AGCCATAACAAAAGTGGGCAAGG No data
1044110706_1044110710 11 Left 1044110706 8:88269371-88269393 CCTTCACAGGGCAACCAAGATAA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1044110710 8:88269405-88269427 AGCCATAACAAAAGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044110710 Original CRISPR AGCCATAACAAAAGTGGGCA AGG Intronic
No off target data available for this crispr