ID: 1044119040

View in Genome Browser
Species Human (GRCh38)
Location 8:88371319-88371341
Sequence AGGTTAATAAACATAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044119040_1044119046 27 Left 1044119040 8:88371319-88371341 CCATGTCCTATGTTTATTAACCT No data
Right 1044119046 8:88371369-88371391 ATTCCTAAGATAGGGTCCTTGGG No data
1044119040_1044119048 30 Left 1044119040 8:88371319-88371341 CCATGTCCTATGTTTATTAACCT No data
Right 1044119048 8:88371372-88371394 CCTAAGATAGGGTCCTTGGGAGG No data
1044119040_1044119045 26 Left 1044119040 8:88371319-88371341 CCATGTCCTATGTTTATTAACCT No data
Right 1044119045 8:88371368-88371390 AATTCCTAAGATAGGGTCCTTGG No data
1044119040_1044119044 19 Left 1044119040 8:88371319-88371341 CCATGTCCTATGTTTATTAACCT No data
Right 1044119044 8:88371361-88371383 TTCACTAAATTCCTAAGATAGGG No data
1044119040_1044119043 18 Left 1044119040 8:88371319-88371341 CCATGTCCTATGTTTATTAACCT No data
Right 1044119043 8:88371360-88371382 ATTCACTAAATTCCTAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044119040 Original CRISPR AGGTTAATAAACATAGGACA TGG (reversed) Intergenic
No off target data available for this crispr