ID: 1044125796

View in Genome Browser
Species Human (GRCh38)
Location 8:88457049-88457071
Sequence TGTTGGCTAGAGAGCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044125796_1044125801 2 Left 1044125796 8:88457049-88457071 CCACCCAAGCTCTCTAGCCAACA No data
Right 1044125801 8:88457074-88457096 GATCTGAATTCCCCCTGGAATGG No data
1044125796_1044125808 18 Left 1044125796 8:88457049-88457071 CCACCCAAGCTCTCTAGCCAACA No data
Right 1044125808 8:88457090-88457112 GGAATGGCGCTCCCAGAGGGAGG No data
1044125796_1044125800 -3 Left 1044125796 8:88457049-88457071 CCACCCAAGCTCTCTAGCCAACA No data
Right 1044125800 8:88457069-88457091 ACAGAGATCTGAATTCCCCCTGG No data
1044125796_1044125807 15 Left 1044125796 8:88457049-88457071 CCACCCAAGCTCTCTAGCCAACA No data
Right 1044125807 8:88457087-88457109 CCTGGAATGGCGCTCCCAGAGGG No data
1044125796_1044125805 14 Left 1044125796 8:88457049-88457071 CCACCCAAGCTCTCTAGCCAACA No data
Right 1044125805 8:88457086-88457108 CCCTGGAATGGCGCTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044125796 Original CRISPR TGTTGGCTAGAGAGCTTGGG TGG (reversed) Intergenic
No off target data available for this crispr