ID: 1044127104

View in Genome Browser
Species Human (GRCh38)
Location 8:88472209-88472231
Sequence CAAAATGCTGAGAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044127104_1044127107 4 Left 1044127104 8:88472209-88472231 CCCATATCACTCTCAGCATTTTG No data
Right 1044127107 8:88472236-88472258 AAGCCATTTAACCAGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044127104 Original CRISPR CAAAATGCTGAGAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr