ID: 1044127328

View in Genome Browser
Species Human (GRCh38)
Location 8:88474432-88474454
Sequence CTGTACCAGCAGAAGCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044127317_1044127328 20 Left 1044127317 8:88474389-88474411 CCCCAGGACCCCAGCCTGGTCAT No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127319_1044127328 18 Left 1044127319 8:88474391-88474413 CCAGGACCCCAGCCTGGTCATGC No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127326_1044127328 -4 Left 1044127326 8:88474413-88474435 CCTACTTACAGGGCAGCTTCTGT No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127320_1044127328 12 Left 1044127320 8:88474397-88474419 CCCCAGCCTGGTCATGCCTACTT No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127316_1044127328 21 Left 1044127316 8:88474388-88474410 CCCCCAGGACCCCAGCCTGGTCA No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127321_1044127328 11 Left 1044127321 8:88474398-88474420 CCCAGCCTGGTCATGCCTACTTA No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127318_1044127328 19 Left 1044127318 8:88474390-88474412 CCCAGGACCCCAGCCTGGTCATG No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127324_1044127328 6 Left 1044127324 8:88474403-88474425 CCTGGTCATGCCTACTTACAGGG No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data
1044127322_1044127328 10 Left 1044127322 8:88474399-88474421 CCAGCCTGGTCATGCCTACTTAC No data
Right 1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044127328 Original CRISPR CTGTACCAGCAGAAGCAAGG TGG Intergenic
No off target data available for this crispr