ID: 1044128738

View in Genome Browser
Species Human (GRCh38)
Location 8:88493081-88493103
Sequence CCTCATTTGCAAAGTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044128738_1044128743 13 Left 1044128738 8:88493081-88493103 CCAGCCCCACTTTGCAAATGAGG No data
Right 1044128743 8:88493117-88493139 AATTGCTAAGAAATATGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044128738 Original CRISPR CCTCATTTGCAAAGTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr