ID: 1044135804

View in Genome Browser
Species Human (GRCh38)
Location 8:88584423-88584445
Sequence CATGAGGTTATAGATCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044135804_1044135808 -9 Left 1044135804 8:88584423-88584445 CCTCTGGGATCTATAACCTCATG No data
Right 1044135808 8:88584437-88584459 AACCTCATGGGGCATCAACCTGG No data
1044135804_1044135812 16 Left 1044135804 8:88584423-88584445 CCTCTGGGATCTATAACCTCATG No data
Right 1044135812 8:88584462-88584484 ACAGTAGGAACACTCCTGTATGG No data
1044135804_1044135810 1 Left 1044135804 8:88584423-88584445 CCTCTGGGATCTATAACCTCATG No data
Right 1044135810 8:88584447-88584469 GGCATCAACCTGGTAACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044135804 Original CRISPR CATGAGGTTATAGATCCCAG AGG (reversed) Intergenic
No off target data available for this crispr