ID: 1044135808

View in Genome Browser
Species Human (GRCh38)
Location 8:88584437-88584459
Sequence AACCTCATGGGGCATCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044135804_1044135808 -9 Left 1044135804 8:88584423-88584445 CCTCTGGGATCTATAACCTCATG No data
Right 1044135808 8:88584437-88584459 AACCTCATGGGGCATCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044135808 Original CRISPR AACCTCATGGGGCATCAACC TGG Intergenic
No off target data available for this crispr