ID: 1044150800

View in Genome Browser
Species Human (GRCh38)
Location 8:88773083-88773105
Sequence GACAGCTCTTTGCCTGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044150798_1044150800 15 Left 1044150798 8:88773045-88773067 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1044150800 8:88773083-88773105 GACAGCTCTTTGCCTGTTAGTGG No data
1044150799_1044150800 11 Left 1044150799 8:88773049-88773071 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1044150800 8:88773083-88773105 GACAGCTCTTTGCCTGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044150800 Original CRISPR GACAGCTCTTTGCCTGTTAG TGG Intergenic
No off target data available for this crispr