ID: 1044151106

View in Genome Browser
Species Human (GRCh38)
Location 8:88775571-88775593
Sequence CTGTAGATACAGATTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044151106_1044151111 28 Left 1044151106 8:88775571-88775593 CCACCCTTAATCTGTATCTACAG No data
Right 1044151111 8:88775622-88775644 CTGTCAGTTGCCAGCATGGCTGG No data
1044151106_1044151109 24 Left 1044151106 8:88775571-88775593 CCACCCTTAATCTGTATCTACAG No data
Right 1044151109 8:88775618-88775640 AATCCTGTCAGTTGCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044151106 Original CRISPR CTGTAGATACAGATTAAGGG TGG (reversed) Intergenic
No off target data available for this crispr