ID: 1044153951

View in Genome Browser
Species Human (GRCh38)
Location 8:88819254-88819276
Sequence AGCTTTTTAAAGATGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044153951_1044153954 23 Left 1044153951 8:88819254-88819276 CCATTCTACATCTTTAAAAAGCT No data
Right 1044153954 8:88819300-88819322 ATACGTAAGGGAAAAAGTGCTGG No data
1044153951_1044153955 24 Left 1044153951 8:88819254-88819276 CCATTCTACATCTTTAAAAAGCT No data
Right 1044153955 8:88819301-88819323 TACGTAAGGGAAAAAGTGCTGGG No data
1044153951_1044153952 10 Left 1044153951 8:88819254-88819276 CCATTCTACATCTTTAAAAAGCT No data
Right 1044153952 8:88819287-88819309 AAGAAACAGACAAATACGTAAGG No data
1044153951_1044153953 11 Left 1044153951 8:88819254-88819276 CCATTCTACATCTTTAAAAAGCT No data
Right 1044153953 8:88819288-88819310 AGAAACAGACAAATACGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044153951 Original CRISPR AGCTTTTTAAAGATGTAGAA TGG (reversed) Intergenic
No off target data available for this crispr