ID: 1044157340

View in Genome Browser
Species Human (GRCh38)
Location 8:88863779-88863801
Sequence GTCCCTACAGAAGGAAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044157340_1044157342 -7 Left 1044157340 8:88863779-88863801 CCTACACTTCCTTCTGTAGGGAC No data
Right 1044157342 8:88863795-88863817 TAGGGACAAGTTGCTTTGTTAGG No data
1044157340_1044157343 21 Left 1044157340 8:88863779-88863801 CCTACACTTCCTTCTGTAGGGAC No data
Right 1044157343 8:88863823-88863845 GCAAATACAGCTCAAAATTATGG No data
1044157340_1044157344 24 Left 1044157340 8:88863779-88863801 CCTACACTTCCTTCTGTAGGGAC No data
Right 1044157344 8:88863826-88863848 AATACAGCTCAAAATTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044157340 Original CRISPR GTCCCTACAGAAGGAAGTGT AGG (reversed) Intergenic
No off target data available for this crispr