ID: 1044158002

View in Genome Browser
Species Human (GRCh38)
Location 8:88874301-88874323
Sequence ATACAATCAAGTATGTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044158002_1044158004 18 Left 1044158002 8:88874301-88874323 CCTAAATACATACTTGATTGTAT No data
Right 1044158004 8:88874342-88874364 TGCCCAAATAATTTTAATTTGGG No data
1044158002_1044158003 17 Left 1044158002 8:88874301-88874323 CCTAAATACATACTTGATTGTAT No data
Right 1044158003 8:88874341-88874363 CTGCCCAAATAATTTTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044158002 Original CRISPR ATACAATCAAGTATGTATTT AGG (reversed) Intergenic
No off target data available for this crispr