ID: 1044159323

View in Genome Browser
Species Human (GRCh38)
Location 8:88893542-88893564
Sequence GAGTTTCCCTGCTCCCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044159323_1044159324 19 Left 1044159323 8:88893542-88893564 CCAACGTGGGAGCAGGGAAACTC No data
Right 1044159324 8:88893584-88893606 CTCAAGACAAAGATAAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044159323 Original CRISPR GAGTTTCCCTGCTCCCACGT TGG (reversed) Intergenic
No off target data available for this crispr