ID: 1044170848

View in Genome Browser
Species Human (GRCh38)
Location 8:89049991-89050013
Sequence TCAGGGGGCCCTGTCCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044170841_1044170848 6 Left 1044170841 8:89049962-89049984 CCTGGTGGAAGGGTCCTTGGGGT No data
Right 1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG No data
1044170835_1044170848 14 Left 1044170835 8:89049954-89049976 CCCAAAGCCCTGGTGGAAGGGTC No data
Right 1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG No data
1044170839_1044170848 7 Left 1044170839 8:89049961-89049983 CCCTGGTGGAAGGGTCCTTGGGG No data
Right 1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG No data
1044170832_1044170848 18 Left 1044170832 8:89049950-89049972 CCGACCCAAAGCCCTGGTGGAAG No data
Right 1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG No data
1044170836_1044170848 13 Left 1044170836 8:89049955-89049977 CCAAAGCCCTGGTGGAAGGGTCC No data
Right 1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG No data
1044170845_1044170848 -8 Left 1044170845 8:89049976-89049998 CCTTGGGGTACCAAGTCAGGGGG No data
Right 1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044170848 Original CRISPR TCAGGGGGCCCTGTCCAGTG AGG Intergenic
No off target data available for this crispr