ID: 1044173078

View in Genome Browser
Species Human (GRCh38)
Location 8:89081314-89081336
Sequence GAGGTAAATTTTCAGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044173071_1044173078 14 Left 1044173071 8:89081277-89081299 CCCCTTGGAAATAGATTACTTTT No data
Right 1044173078 8:89081314-89081336 GAGGTAAATTTTCAGATGCAGGG No data
1044173072_1044173078 13 Left 1044173072 8:89081278-89081300 CCCTTGGAAATAGATTACTTTTA No data
Right 1044173078 8:89081314-89081336 GAGGTAAATTTTCAGATGCAGGG No data
1044173073_1044173078 12 Left 1044173073 8:89081279-89081301 CCTTGGAAATAGATTACTTTTAT No data
Right 1044173078 8:89081314-89081336 GAGGTAAATTTTCAGATGCAGGG No data
1044173070_1044173078 28 Left 1044173070 8:89081263-89081285 CCTATGTCTTCACTCCCCTTGGA No data
Right 1044173078 8:89081314-89081336 GAGGTAAATTTTCAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044173078 Original CRISPR GAGGTAAATTTTCAGATGCA GGG Intergenic
No off target data available for this crispr