ID: 1044190166

View in Genome Browser
Species Human (GRCh38)
Location 8:89306560-89306582
Sequence CTGTAGACACTGATTTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044190166_1044190173 21 Left 1044190166 8:89306560-89306582 CCCTCCCAAATCAGTGTCTACAG No data
Right 1044190173 8:89306604-89306626 AAATTAAATTCAGTCGCAGGAGG No data
1044190166_1044190172 18 Left 1044190166 8:89306560-89306582 CCCTCCCAAATCAGTGTCTACAG No data
Right 1044190172 8:89306601-89306623 TGTAAATTAAATTCAGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044190166 Original CRISPR CTGTAGACACTGATTTGGGA GGG (reversed) Intergenic
No off target data available for this crispr