ID: 1044190715

View in Genome Browser
Species Human (GRCh38)
Location 8:89313559-89313581
Sequence TGGCTTTTACATATAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044190709_1044190715 13 Left 1044190709 8:89313523-89313545 CCCTTCATCTTTGATAGTGCCAG No data
Right 1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG No data
1044190714_1044190715 -6 Left 1044190714 8:89313542-89313564 CCAGGCAAAGGAAGTGATGGCTT No data
Right 1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG No data
1044190710_1044190715 12 Left 1044190710 8:89313524-89313546 CCTTCATCTTTGATAGTGCCAGG No data
Right 1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044190715 Original CRISPR TGGCTTTTACATATAGAGTA AGG Intergenic
No off target data available for this crispr