ID: 1044192176

View in Genome Browser
Species Human (GRCh38)
Location 8:89332073-89332095
Sequence GGTTTATAGGGAACATGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044192176_1044192180 15 Left 1044192176 8:89332073-89332095 CCAAATCATGTTCCCTATAAACC No data
Right 1044192180 8:89332111-89332133 TCAGATAGTGTGAGTATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044192176 Original CRISPR GGTTTATAGGGAACATGATT TGG (reversed) Intergenic
No off target data available for this crispr