ID: 1044195299

View in Genome Browser
Species Human (GRCh38)
Location 8:89369291-89369313
Sequence ACTTATCAGGTACAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044195299_1044195306 29 Left 1044195299 8:89369291-89369313 CCACACAACTGTACCTGATAAGT No data
Right 1044195306 8:89369343-89369365 CTGCATATGAAATATAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044195299 Original CRISPR ACTTATCAGGTACAGTTGTG TGG (reversed) Intergenic
No off target data available for this crispr